Incidental Mutation 'R7042:Fmo2'
ID547091
Institutional Source Beutler Lab
Gene Symbol Fmo2
Ensembl Gene ENSMUSG00000040170
Gene Nameflavin containing monooxygenase 2
Synonyms2310008D08Rik, 2310042I22Rik
MMRRC Submission
Accession Numbers

Genbank: NM_018881

Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R7042 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location162874317-162898726 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 162880657 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 303 (V303A)
Ref Sequence ENSEMBL: ENSMUSP00000107135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045902] [ENSMUST00000111510]
Predicted Effect probably damaging
Transcript: ENSMUST00000045902
AA Change: V303A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000044405
Gene: ENSMUSG00000040170
AA Change: V303A

DomainStartEndE-ValueType
Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 3 230 6.4e-12 PFAM
Pfam:Pyr_redox_3 6 220 4.4e-10 PFAM
Pfam:K_oxygenase 69 233 2.2e-11 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111510
AA Change: V303A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000107135
Gene: ENSMUSG00000040170
AA Change: V303A

DomainStartEndE-ValueType
Pfam:FMO-like 2 533 8.7e-296 PFAM
Pfam:Pyr_redox_2 4 446 1.3e-6 PFAM
Pfam:Pyr_redox_3 6 220 8e-17 PFAM
Pfam:NAD_binding_8 7 72 4.3e-6 PFAM
Pfam:K_oxygenase 78 333 1.3e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (54/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a flavin-containing monooxygenase family member. It is an NADPH-dependent enzyme that catalyzes the N-oxidation of some primary alkylamines through an N-hydroxylamine intermediate. However, some human populations contain an allele (FMO2*2A) with a premature stop codon, resulting in a protein that is C-terminally-truncated, has no catalytic activity, and is likely degraded rapidly. This gene is found in a cluster with other related family members on chromosome 1. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2014]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700061G19Rik A G 17: 56,885,098 S554G possibly damaging Het
Adcy7 G T 8: 88,315,750 R415L probably damaging Het
Aox1 A T 1: 58,102,600 I1182F probably damaging Het
Ccdc7b T A 8: 129,085,249 Y147N probably benign Het
Clcnka A G 4: 141,391,380 I398T probably damaging Het
Cst8 T A 2: 148,799,876 probably null Het
Dcxr T C 11: 120,727,015 D45G possibly damaging Het
Dhx38 A T 8: 109,556,985 M510K possibly damaging Het
Ebf1 T A 11: 44,991,511 H431Q probably damaging Het
Eml4 T C 17: 83,461,570 I681T probably damaging Het
Etf1 T C 18: 34,910,166 N164S probably benign Het
Foxl2 T A 9: 98,955,662 M1K probably null Het
Gm3404 A T 5: 146,526,159 E50D probably benign Het
Gpr61 G A 3: 108,151,331 P5S possibly damaging Het
Hcrtr1 A G 4: 130,130,860 probably benign Het
Ier3ip1 T A 18: 76,930,132 F3I possibly damaging Het
Ifi206 G A 1: 173,481,242 P396L Het
Ifi209 G A 1: 173,642,670 V275I probably benign Het
Ighv1-69 T C 12: 115,623,289 S75G probably benign Het
Kcnj3 A T 2: 55,594,865 H325L possibly damaging Het
Klrk1 A T 6: 129,616,771 S50T possibly damaging Het
Mfsd4b4 T A 10: 39,892,518 Y193F probably damaging Het
Nlrp5 A G 7: 23,417,480 I210V possibly damaging Het
Olfr1135 A T 2: 87,671,591 Y259N possibly damaging Het
Olfr1181 T A 2: 88,423,402 I208F possibly damaging Het
Olfr147 G T 9: 38,402,900 G6C probably damaging Het
Olfr930 A G 9: 38,930,326 S52G possibly damaging Het
Pax6 A T 2: 105,696,373 H208L probably benign Het
Pgc C A 17: 47,733,820 Q331K probably benign Het
Phldb1 A G 9: 44,694,424 S370P probably damaging Het
Pi4k2a T C 19: 42,104,898 I226T probably benign Het
Pick1 T C 15: 79,248,765 S342P probably damaging Het
Plscr1 A G 9: 92,271,535 M312V probably damaging Het
Ppp3cc T G 14: 70,225,019 K399Q probably benign Het
Qpctl T C 7: 19,147,018 H163R probably benign Het
Rab11fip5 A G 6: 85,374,128 V134A possibly damaging Het
Rasal1 T A 5: 120,663,960 probably null Het
Rem2 T A 14: 54,478,091 I171N probably damaging Het
Sec22a T A 16: 35,329,515 I214L probably benign Het
Setbp1 T C 18: 79,086,855 D54G probably damaging Het
Slc27a2 C T 2: 126,567,780 A294V probably damaging Het
Slfn14 T A 11: 83,276,604 D695V probably damaging Het
Smc6 T A 12: 11,309,300 I975K probably damaging Het
Spice1 T C 16: 44,385,680 F835L probably benign Het
Tars2 A T 3: 95,750,745 H222Q probably benign Het
Tmtc2 A T 10: 105,370,616 F273I probably damaging Het
Ttc39d C A 17: 80,216,462 D183E probably benign Het
Vasp A G 7: 19,262,021 S128P probably benign Het
Vcpip1 A G 1: 9,748,153 S2P unknown Het
Vmn2r98 T C 17: 19,080,922 Y729H probably benign Het
Wdr18 A T 10: 79,966,110 D243V probably benign Het
Wdr60 T C 12: 116,254,441 I182M probably benign Het
Xirp2 T C 2: 67,513,289 V1958A probably benign Het
Zfp451 A T 1: 33,777,393 M492K probably damaging Het
Zfp804b A G 5: 6,770,042 I1007T probably benign Het
Other mutations in Fmo2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Fmo2 APN 1 162888713 nonsense probably null
IGL01299:Fmo2 APN 1 162878030 missense probably benign
IGL02617:Fmo2 APN 1 162876921 missense probably damaging 1.00
IGL02994:Fmo2 APN 1 162880620 missense probably damaging 1.00
IGL03270:Fmo2 APN 1 162882026 missense probably damaging 1.00
F5493:Fmo2 UTSW 1 162880532 missense probably benign 0.41
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0058:Fmo2 UTSW 1 162886324 missense probably benign 0.38
R0501:Fmo2 UTSW 1 162876928 missense probably benign 0.00
R0658:Fmo2 UTSW 1 162876774 missense possibly damaging 0.57
R0800:Fmo2 UTSW 1 162876814 missense probably benign 0.00
R2223:Fmo2 UTSW 1 162898244 missense probably damaging 1.00
R4360:Fmo2 UTSW 1 162882014 missense probably damaging 0.99
R4523:Fmo2 UTSW 1 162887708 missense probably benign 0.44
R4755:Fmo2 UTSW 1 162888805 missense probably damaging 1.00
R6087:Fmo2 UTSW 1 162880433 missense probably benign 0.45
R6219:Fmo2 UTSW 1 162880516 missense probably damaging 0.97
R6668:Fmo2 UTSW 1 162877048 missense probably benign 0.15
R7291:Fmo2 UTSW 1 162887702 missense probably benign 0.06
R7560:Fmo2 UTSW 1 162888749 missense probably damaging 1.00
R7580:Fmo2 UTSW 1 162877044 missense possibly damaging 0.46
R7657:Fmo2 UTSW 1 162888844 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGGATGAGACCTATGCACG -3'
(R):5'- GTTTGGGGCAGGCAAATTAG -3'

Sequencing Primer
(F):5'- ACGCAAGGGTTGGCTTCTC -3'
(R):5'- GGCAAATTAGTTGAGTTAGAGTTTCC -3'
Posted On2019-05-13