Incidental Mutation 'R7080:Olfr215'
ID549461
Institutional Source Beutler Lab
Gene Symbol Olfr215
Ensembl Gene ENSMUSG00000050654
Gene Nameolfactory receptor 215
SynonymsMOR119-2, GA_x54KRFPKN04-58217732-58216800
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R7080 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location116580084-116584195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 116582353 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Isoleucine at position 198 (F198I)
Ref Sequence ENSEMBL: ENSMUSP00000052425 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061723]
Predicted Effect probably damaging
Transcript: ENSMUST00000061723
AA Change: F198I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000052425
Gene: ENSMUSG00000050654
AA Change: F198I

DomainStartEndE-ValueType
Pfam:7tm_4 29 306 5e-47 PFAM
Pfam:7TM_GPCR_Srsx 33 258 1.8e-5 PFAM
Pfam:7tm_1 39 288 2.9e-15 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 94% (47/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca2 A G 2: 25,446,104 E2162G probably benign Het
Ackr4 A G 9: 104,099,562 V62A probably damaging Het
Atox1 T A 11: 55,450,539 K57* probably null Het
Atp6v1e1 G A 6: 120,822,389 probably benign Het
B020031M17Rik T C 13: 119,949,734 D112G probably benign Het
Bmpr2 T C 1: 59,867,683 V645A probably benign Het
Brwd1 T C 16: 96,009,530 T1602A probably benign Het
Cdc42bpg T C 19: 6,315,189 V692A probably damaging Het
Cdca2 T C 14: 67,698,102 D388G probably damaging Het
Celsr1 G A 15: 85,932,451 R1764C possibly damaging Het
Copz2 G T 11: 96,856,712 V174L probably benign Het
Dnaaf1 T C 8: 119,582,596 L141P probably damaging Het
Fam170a T A 18: 50,280,673 probably null Het
Fshr A T 17: 89,097,111 probably null Het
Gbx1 C T 5: 24,526,300 A173T probably benign Het
Gm3604 G A 13: 62,370,295 A83V probably damaging Het
Gpr19 A T 6: 134,870,456 V88D probably damaging Het
Hnrnpd C T 5: 99,976,533 probably null Het
Homez T C 14: 54,857,655 S199G probably benign Het
Kit T C 5: 75,607,281 I108T probably damaging Het
Lrrc34 A C 3: 30,634,556 Y199D probably damaging Het
Mapk12 T C 15: 89,133,147 D208G probably damaging Het
Mon1a A G 9: 107,901,786 D403G probably damaging Het
Myo1d C T 11: 80,674,634 E426K probably damaging Het
Nol11 G A 11: 107,180,052 T307I probably damaging Het
Olfr1066 A T 2: 86,455,491 L260* probably null Het
Olfr1107 A G 2: 87,071,739 Y132H probably damaging Het
Olfr547 A T 7: 102,534,965 I73F possibly damaging Het
Olfr975 A G 9: 39,950,148 C208R probably damaging Het
Pcdhb16 C T 18: 37,478,463 Q159* probably null Het
Phf19 G A 2: 34,898,712 probably null Het
Qrfpr C T 3: 36,180,049 R381H probably benign Het
Rad51ap2 A G 12: 11,456,365 D96G probably benign Het
Ranbp1 T C 16: 18,245,233 D93G possibly damaging Het
Reep1 A G 6: 71,780,765 D116G possibly damaging Het
Rinl T C 7: 28,796,676 C361R probably damaging Het
Rps6kb1 T C 11: 86,506,840 D393G probably damaging Het
Slc2a12 T C 10: 22,665,317 V357A probably benign Het
Spryd3 T C 15: 102,118,192 D348G probably benign Het
Syne2 G A 12: 76,052,727 A569T probably benign Het
Thoc6 C T 17: 23,673,529 R6Q probably null Het
Tyw3 G C 3: 154,593,789 S94R probably benign Het
Unc13b C T 4: 43,171,926 T918I unknown Het
Unc80 A T 1: 66,646,521 H2268L possibly damaging Het
Urod C T 4: 116,992,641 A187T probably damaging Het
Usp46 G T 5: 74,016,683 N205K probably benign Het
Wapl T C 14: 34,692,356 F392L probably benign Het
Zim1 T C 7: 6,677,306 T453A possibly damaging Het
Other mutations in Olfr215
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01666:Olfr215 APN 6 116582335 missense possibly damaging 0.93
IGL02959:Olfr215 APN 6 116582544 missense probably damaging 1.00
IGL03053:Olfr215 APN 6 116582245 missense possibly damaging 0.50
R0078:Olfr215 UTSW 6 116582740 missense probably damaging 0.96
R0277:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0323:Olfr215 UTSW 6 116582601 missense probably damaging 0.99
R0399:Olfr215 UTSW 6 116582781 missense probably benign 0.00
R0545:Olfr215 UTSW 6 116582656 missense probably benign 0.01
R1213:Olfr215 UTSW 6 116582866 missense probably benign 0.00
R1775:Olfr215 UTSW 6 116582964 start gained probably benign
R1789:Olfr215 UTSW 6 116582697 missense probably damaging 1.00
R4724:Olfr215 UTSW 6 116582937 missense probably damaging 1.00
R5391:Olfr215 UTSW 6 116582847 missense probably damaging 1.00
R5392:Olfr215 UTSW 6 116582418 missense probably damaging 1.00
R5686:Olfr215 UTSW 6 116582929 missense probably benign 0.00
R6124:Olfr215 UTSW 6 116582485 missense probably benign 0.05
R7355:Olfr215 UTSW 6 116582955 start gained probably benign
Z1177:Olfr215 UTSW 6 116582553 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGTTCACAAGAGCAGCCTC -3'
(R):5'- AATTATGGCCTGCCTTGCTC -3'

Sequencing Primer
(F):5'- CAGCCTCTCGGTTGGATTCAAG -3'
(R):5'- CTGACCTTCACCCTGATCACG -3'
Posted On2019-05-15