Incidental Mutation 'R7099:Neu3'
ID 550705
Institutional Source Beutler Lab
Gene Symbol Neu3
Ensembl Gene ENSMUSG00000035239
Gene Name neuraminidase 3
Synonyms ganglioside sialidase, membrane sialidase
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock # R7099 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 99811439-99828417 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 99813820 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 232 (T232M)
Ref Sequence ENSEMBL: ENSMUSP00000045222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036331]
AlphaFold Q9JMH7
Predicted Effect possibly damaging
Transcript: ENSMUST00000036331
AA Change: T232M

PolyPhen 2 Score 0.512 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000045222
Gene: ENSMUSG00000035239
AA Change: T232M

DomainStartEndE-ValueType
Pfam:BNR_2 36 382 6.2e-40 PFAM
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. It is localized in the plasma membrane, and its activity is specific for gangliosides. It may play a role in modulating the ganglioside content of the lipid bilayer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased colon carcinogenesis induced by azoxymethane and dextran sodium sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930453N24Rik C T 16: 64,770,788 A26T probably benign Het
Acly T C 11: 100,492,291 probably null Het
Adam29 A C 8: 55,871,404 L672V probably benign Het
Adgrf1 T C 17: 43,310,602 S577P probably benign Het
Ankar T C 1: 72,643,293 K1371R probably damaging Het
Arid5b T C 10: 68,098,179 D631G probably damaging Het
Brpf3 T C 17: 28,806,637 V228A probably benign Het
C3 T C 17: 57,206,276 D1457G probably benign Het
Calr4 A T 4: 109,242,229 N143I probably benign Het
Catsperd T G 17: 56,628,811 probably null Het
Cobl T A 11: 12,296,540 H154L Het
Cryzl2 G A 1: 157,488,584 probably benign Het
Dennd1c A G 17: 57,067,915 probably null Het
Dnah8 A T 17: 30,704,724 D1222V possibly damaging Het
Errfi1 T C 4: 150,866,768 S218P probably benign Het
Fbxw27 G T 9: 109,770,155 T398N probably damaging Het
Fhod3 A G 18: 25,090,162 D855G probably benign Het
Flii A G 11: 60,720,655 V410A probably benign Het
Fsip2 C A 2: 82,987,624 P4567Q probably benign Het
Fxyd1 T G 7: 31,053,033 Q66H probably damaging Het
Gdi1 G A X: 74,306,855 R55H probably benign Het
Gramd3 C T 18: 56,491,945 T370I probably benign Het
Kdr A G 5: 75,944,333 V1079A probably damaging Het
Lmx1a G A 1: 167,830,546 G166D probably damaging Het
Lrrfip2 A G 9: 111,173,108 R92G probably benign Het
Map1a T A 2: 121,300,517 S605T probably benign Het
Megf8 A T 7: 25,346,520 D1496V probably damaging Het
Mgam T C 6: 40,661,716 V461A probably benign Het
Muc6 AGGCGCAGAAACCCTGGC AGGC 7: 141,634,450 probably null Het
Nav3 T C 10: 109,703,334 T2069A probably benign Het
Nbeal2 A T 9: 110,645,438 probably null Het
Ndst1 A G 18: 60,695,500 F661L possibly damaging Het
Nf1 T C 11: 79,570,330 S741P probably benign Het
Nr5a1 G T 2: 38,694,136 L424M probably damaging Het
Nuf2 G A 1: 169,506,072 T345M probably benign Het
Olfr1301 A T 2: 111,755,076 T276S probably benign Het
Olfr1426 A G 19: 12,088,166 F209L possibly damaging Het
Olfr212 T A 6: 116,516,760 *328R probably null Het
Olfr952 G A 9: 39,426,303 T256I probably benign Het
Otud7a A G 7: 63,757,455 E502G possibly damaging Het
Otulin A G 15: 27,608,746 L237S probably damaging Het
Pias1 A G 9: 62,881,145 M79T Het
Prom2 T C 2: 127,539,778 E206G probably benign Het
Scarb1 A T 5: 125,304,350 N43K probably damaging Het
Sdad1 A G 5: 92,293,973 V365A possibly damaging Het
Sdk2 T C 11: 113,834,905 T1173A probably damaging Het
Sidt1 A G 16: 44,243,497 S803P probably damaging Het
Slc45a1 A T 4: 150,629,573 D738E probably benign Het
Slc4a7 T A 14: 14,733,750 H53Q probably damaging Het
Spata22 T C 11: 73,340,399 F160L probably benign Het
Stag1 G A 9: 100,944,826 V949I probably benign Het
Syne1 T C 10: 5,123,744 S1200G probably benign Het
Tbc1d9 A G 8: 83,254,891 E729G probably damaging Het
Tcaf2 C T 6: 42,630,341 M226I probably benign Het
Tep1 T C 14: 50,844,487 probably null Het
Tigd2 C A 6: 59,210,181 T11K probably damaging Het
Trappc9 A G 15: 72,693,619 V941A probably benign Het
Ugt2b37 A G 5: 87,240,989 M455T probably benign Het
Usp42 A T 5: 143,726,645 S95T probably damaging Het
Usp44 T C 10: 93,850,187 I488T possibly damaging Het
Vmn1r73 T C 7: 11,756,393 I46T probably damaging Het
Vmn2r34 A T 7: 7,672,541 I616N probably damaging Het
Zfp352 A G 4: 90,224,880 K419R probably benign Het
Zfp595 T A 13: 67,317,647 H187L probably damaging Het
Zfp804b A T 5: 6,772,161 S301T probably benign Het
Zzef1 T C 11: 72,872,649 V1374A possibly damaging Het
Other mutations in Neu3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Neu3 APN 7 99813880 missense probably benign 0.00
IGL01338:Neu3 APN 7 99813422 missense probably damaging 1.00
IGL01530:Neu3 APN 7 99813746 missense probably benign 0.00
R0395:Neu3 UTSW 7 99813778 missense probably benign
R0519:Neu3 UTSW 7 99823317 splice site probably benign
R0555:Neu3 UTSW 7 99814183 missense probably damaging 1.00
R1659:Neu3 UTSW 7 99813433 missense probably damaging 0.99
R1706:Neu3 UTSW 7 99823356 missense probably damaging 0.99
R1893:Neu3 UTSW 7 99823420 missense possibly damaging 0.81
R2271:Neu3 UTSW 7 99813443 missense probably benign 0.00
R2472:Neu3 UTSW 7 99813407 missense probably damaging 1.00
R4962:Neu3 UTSW 7 99823408 missense probably damaging 1.00
R5589:Neu3 UTSW 7 99823429 missense probably benign 0.01
R5932:Neu3 UTSW 7 99813318 nonsense probably null
R6307:Neu3 UTSW 7 99813722 missense probably benign
R7072:Neu3 UTSW 7 99814197 nonsense probably null
R7582:Neu3 UTSW 7 99813967 missense probably benign 0.02
R8057:Neu3 UTSW 7 99814228 missense probably benign 0.08
R8497:Neu3 UTSW 7 99823135 splice site probably null
X0023:Neu3 UTSW 7 99813604 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CCTTTGCCAATTGAGTCTTGATAGG -3'
(R):5'- ATCCAGCTACACTCGGGAAG -3'

Sequencing Primer
(F):5'- AGGTATTTGGCATCTTCAAAGGCC -3'
(R):5'- TACACTCGGGAAGGCTGATCATC -3'
Posted On 2019-05-15