Incidental Mutation 'R1706:Neu3'
ID 190074
Institutional Source Beutler Lab
Gene Symbol Neu3
Ensembl Gene ENSMUSG00000035239
Gene Name neuraminidase 3
Synonyms ganglioside sialidase, membrane sialidase
MMRRC Submission 039739-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.051) question?
Stock # R1706 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 99811439-99828417 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 99823356 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 58 (L58P)
Ref Sequence ENSEMBL: ENSMUSP00000045222 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036331]
AlphaFold Q9JMH7
Predicted Effect probably damaging
Transcript: ENSMUST00000036331
AA Change: L58P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045222
Gene: ENSMUSG00000035239
AA Change: L58P

DomainStartEndE-ValueType
Pfam:BNR_2 36 382 6.2e-40 PFAM
Meta Mutation Damage Score 0.8290 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.6%
Validation Efficiency 100% (60/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene product belongs to a family of glycohydrolytic enzymes which remove sialic acid residues from glycoproteins and glycolipids. It is localized in the plasma membrane, and its activity is specific for gangliosides. It may play a role in modulating the ganglioside content of the lipid bilayer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased colon carcinogenesis induced by azoxymethane and dextran sodium sulfate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921524L21Rik T C 18: 6,624,059 probably benign Het
4931406C07Rik G A 9: 15,297,857 T47I probably damaging Het
Adcy2 T A 13: 68,720,746 N558I probably damaging Het
Ago3 G A 4: 126,370,292 P374S probably damaging Het
Ak8 T C 2: 28,759,995 C345R possibly damaging Het
Akap8l C T 17: 32,332,483 R511H probably damaging Het
BC005624 T C 2: 30,978,910 E84G possibly damaging Het
Cav1 T C 6: 17,339,182 F89L probably damaging Het
Cfap206 G A 4: 34,688,875 P593L probably damaging Het
Clcn6 G A 4: 148,017,568 T353I probably benign Het
Cstl1 G A 2: 148,751,159 probably null Het
Cyp2d10 A C 15: 82,405,582 S140A probably damaging Het
D130052B06Rik G A 11: 33,616,230 R18H unknown Het
Ddi2 A G 4: 141,683,997 F535L probably benign Het
Dopey1 C T 9: 86,554,080 T2383M possibly damaging Het
Duox1 A G 2: 122,319,472 T115A probably benign Het
Ercc6l2 T A 13: 63,872,458 probably benign Het
Gm7052 A G 17: 22,039,842 probably benign Het
Gm9925 G A 18: 74,065,502 probably benign Het
Gnas T A 2: 174,299,975 S646T possibly damaging Het
Gpatch3 T A 4: 133,575,173 C138* probably null Het
Igsf8 C T 1: 172,317,405 R100C probably damaging Het
Kcnh3 A G 15: 99,238,078 K652R possibly damaging Het
Kcnn4 T A 7: 24,374,742 V77E probably damaging Het
Kif13b T A 14: 64,760,666 probably benign Het
Lca5l T C 16: 96,175,964 N214S probably benign Het
Luc7l3 T C 11: 94,297,756 probably benign Het
Lypd3 T C 7: 24,640,330 I274T probably benign Het
Macf1 A G 4: 123,370,584 probably null Het
Mchr1 A G 15: 81,237,163 Y38C probably damaging Het
Mia2 T A 12: 59,144,766 L716* probably null Het
Mki67 A G 7: 135,700,566 L913P probably benign Het
Mug2 T A 6: 122,036,232 probably benign Het
Olfr1099 A T 2: 86,959,080 I126N probably damaging Het
Olfr1198 G A 2: 88,746,138 P250L probably damaging Het
Pak1ip1 T C 13: 41,012,688 V363A probably benign Het
Pcdhb16 A G 18: 37,479,652 D555G probably benign Het
Pygb G A 2: 150,827,147 G671D probably damaging Het
Rab30 A T 7: 92,829,667 I79L possibly damaging Het
Rab44 C A 17: 29,138,106 T70K probably damaging Het
Rccd1 C G 7: 80,320,663 G69R possibly damaging Het
Sema5b T C 16: 35,649,755 V329A probably damaging Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Slc22a14 T C 9: 119,180,984 N15S probably benign Het
Smurf2 G A 11: 106,824,747 H632Y probably damaging Het
Syt10 C T 15: 89,790,776 D456N probably damaging Het
Tex10 C T 4: 48,456,800 R637Q probably benign Het
Tgm6 T C 2: 130,145,159 C516R possibly damaging Het
Tmprss9 T C 10: 80,898,187 probably benign Het
Trim67 A G 8: 124,794,421 N174S probably damaging Het
Ttc8 C A 12: 98,943,883 T123K probably benign Het
Ugt1a7c T A 1: 88,095,725 M202K probably damaging Het
Vmn2r7 T A 3: 64,691,459 H559L possibly damaging Het
Zfp511 A G 7: 140,037,279 D96G probably benign Het
Zfp868 A G 8: 69,612,409 Y92H probably benign Het
Zzz3 T A 3: 152,449,098 D633E probably damaging Het
Other mutations in Neu3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01149:Neu3 APN 7 99813880 missense probably benign 0.00
IGL01338:Neu3 APN 7 99813422 missense probably damaging 1.00
IGL01530:Neu3 APN 7 99813746 missense probably benign 0.00
R0395:Neu3 UTSW 7 99813778 missense probably benign
R0519:Neu3 UTSW 7 99823317 splice site probably benign
R0555:Neu3 UTSW 7 99814183 missense probably damaging 1.00
R1659:Neu3 UTSW 7 99813433 missense probably damaging 0.99
R1893:Neu3 UTSW 7 99823420 missense possibly damaging 0.81
R2271:Neu3 UTSW 7 99813443 missense probably benign 0.00
R2472:Neu3 UTSW 7 99813407 missense probably damaging 1.00
R4962:Neu3 UTSW 7 99823408 missense probably damaging 1.00
R5589:Neu3 UTSW 7 99823429 missense probably benign 0.01
R5932:Neu3 UTSW 7 99813318 nonsense probably null
R6307:Neu3 UTSW 7 99813722 missense probably benign
R7072:Neu3 UTSW 7 99814197 nonsense probably null
R7099:Neu3 UTSW 7 99813820 missense possibly damaging 0.51
R7582:Neu3 UTSW 7 99813967 missense probably benign 0.02
R8057:Neu3 UTSW 7 99814228 missense probably benign 0.08
R8497:Neu3 UTSW 7 99823135 splice site probably null
X0023:Neu3 UTSW 7 99813604 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AGGCTGTGGAGATGCTATGTATCCC -3'
(R):5'- CCTCGGCAATGAAATGAGCAGGAAC -3'

Sequencing Primer
(F):5'- CACCAAGTTTTACTGGCAAAGG -3'
(R):5'- GAACTGTTTCCTGTCCTTACAGAAG -3'
Posted On 2014-05-14