Incidental Mutation 'R7139:Pcyox1'
ID553261
Institutional Source Beutler Lab
Gene Symbol Pcyox1
Ensembl Gene ENSMUSG00000029998
Gene Nameprenylcysteine oxidase 1
Synonyms1200015P13Rik, Pcly, PCL1
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7139 (G1)
Quality Score225.009
Status Not validated
Chromosome6
Chromosomal Location86386006-86397154 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 86394537 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 122 (N122K)
Ref Sequence ENSEMBL: ENSMUSP00000032065 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032065] [ENSMUST00000153723] [ENSMUST00000204116]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032065
AA Change: N122K

PolyPhen 2 Score 0.495 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032065
Gene: ENSMUSG00000029998
AA Change: N122K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 8.2e-13 PFAM
Pfam:Amino_oxidase 44 346 7.1e-9 PFAM
Pfam:Prenylcys_lyase 128 501 8.1e-157 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131500
SMART Domains Protein: ENSMUSP00000122602
Gene: ENSMUSG00000029998

DomainStartEndE-ValueType
Pfam:Prenylcys_lyase 1 73 6.1e-25 PFAM
Pfam:Prenylcys_lyase 69 197 7.1e-40 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000153723
AA Change: N53K

PolyPhen 2 Score 0.889 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119449
Gene: ENSMUSG00000029998
AA Change: N53K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:Prenylcys_lyase 59 181 5.5e-67 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000204116
AA Change: N122K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000145474
Gene: ENSMUSG00000029998
AA Change: N122K

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:NAD_binding_8 39 106 4.9e-12 PFAM
Pfam:Amino_oxidase 44 136 3.3e-7 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prenylcysteine is released during the degradation of prenylated proteins. PCYOX1 catalyzes the degradation of prenylcysteine to yield free cysteines and a hydrophobic isoprenoid product (Tschantz et al., 1999 [PubMed 10585463]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are viable, fertile and free of obvious pathology despite a striking accumulation of both farnesylcysteine and geranylgeranylcysteine in brain and liver. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,941,838 R272G possibly damaging Het
4930512M02Rik T A 11: 11,590,078 N179Y unknown Het
4930562C15Rik A T 16: 4,850,184 M480L probably benign Het
Abcd4 A G 12: 84,606,298 C377R probably benign Het
Adam23 C A 1: 63,545,577 D381E probably damaging Het
Angpt1 T A 15: 42,676,351 Q37H probably damaging Het
Apeh A T 9: 108,092,146 F260I probably damaging Het
Cadps2 T C 6: 23,410,889 Y681C probably damaging Het
Ccdc162 T C 10: 41,666,721 M386V possibly damaging Het
Celsr2 T C 3: 108,415,359 S46G unknown Het
Cfc1 T C 1: 34,536,479 L78P probably benign Het
Chd7 T C 4: 8,865,865 V2724A probably benign Het
Clca3a1 A T 3: 144,755,302 V196E possibly damaging Het
Cma1 T C 14: 55,943,816 H44R probably damaging Het
Cnot2 T C 10: 116,495,019 N394S probably benign Het
Cstf3 A T 2: 104,653,064 I372F possibly damaging Het
Cyb5rl A C 4: 107,071,011 I115L probably benign Het
D5Ertd579e A G 5: 36,613,976 L1025P probably damaging Het
Dmtn T C 14: 70,617,427 N36S probably benign Het
Dnah6 A G 6: 73,135,680 V1647A probably damaging Het
Dock6 T C 9: 21,801,276 Y2063C probably damaging Het
Dst T A 1: 34,299,807 D5149E probably damaging Het
Fancl A G 11: 26,403,358 M85V probably benign Het
Fgd2 T A 17: 29,373,255 F387Y probably damaging Het
Fshr A T 17: 88,986,161 I363N possibly damaging Het
Glce G T 9: 62,070,434 S56* probably null Het
Gm26727 A T 2: 67,433,037 S49T unknown Het
Gm36210 T A 7: 4,899,278 D131V probably damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
H2afy2 T A 10: 61,757,895 M1L unknown Het
H2-Eb2 C T 17: 34,334,421 R194W probably benign Het
Hivep1 A T 13: 42,159,954 E1890V probably benign Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Ighv2-5 T A 12: 113,685,599 Y78F probably benign Het
Il9 C T 13: 56,480,613 V88I probably benign Het
Kidins220 A G 12: 24,994,821 T163A probably damaging Het
Lama4 G T 10: 39,075,495 D1079Y probably damaging Het
Lman1l A T 9: 57,615,596 H160Q probably benign Het
Lrrc34 T C 3: 30,624,887 I354V probably benign Het
Mpeg1 A T 19: 12,461,714 T179S probably benign Het
Mrgpra2a A T 7: 47,426,589 L307H probably damaging Het
Mst1 G A 9: 108,082,828 R328H probably damaging Het
Nav3 C A 10: 109,853,477 S313I probably benign Het
Nmt2 T G 2: 3,284,315 S7A probably benign Het
Nsmce1 T C 7: 125,469,082 S197G probably benign Het
Ociad2 A G 5: 73,335,875 V4A probably benign Het
Olfr680-ps1 G T 7: 105,092,798 T7K probably benign Het
Osmr T C 15: 6,821,088 D679G possibly damaging Het
Pappa T A 4: 65,189,450 F699L probably benign Het
Parp8 T A 13: 117,025,266 M40L probably benign Het
Pkd1l1 T C 11: 8,890,737 S1224G Het
Pkd1l3 T A 8: 109,636,340 S1088T probably damaging Het
Prrt1 T C 17: 34,631,077 V155A probably benign Het
Rbm6 A C 9: 107,853,211 D79E probably damaging Het
Sec31b A T 19: 44,518,936 S819T probably benign Het
Slc22a27 A T 19: 7,926,547 I75N probably damaging Het
Slc25a54 G A 3: 109,098,589 G138R probably damaging Het
Slc6a12 T C 6: 121,365,319 S612P probably benign Het
Slc7a2 A T 8: 40,915,013 I605F probably benign Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Strbp A T 2: 37,624,502 H308Q probably benign Het
Stxbp4 G A 11: 90,607,009 Q155* probably null Het
Sybu A T 15: 44,677,714 N317K possibly damaging Het
Taok1 G A 11: 77,571,633 S210F probably damaging Het
Tapbp A G 17: 33,920,048 D72G possibly damaging Het
Thbd G T 2: 148,406,541 T469K probably benign Het
Tia1 T C 6: 86,427,688 Y302H possibly damaging Het
Tlr4 T C 4: 66,840,283 F438L probably benign Het
Tmem235 C T 11: 117,860,897 S49L probably damaging Het
Trip4 A G 9: 65,885,221 probably benign Het
Trrap C A 5: 144,803,178 L1137I possibly damaging Het
Vmo1 T C 11: 70,513,848 E109G probably benign Het
Wdfy4 T C 14: 33,151,578 Y258C Het
Wdr91 T G 6: 34,908,263 N121T possibly damaging Het
Zfp39 T C 11: 58,890,559 H459R probably damaging Het
Zfp936 T A 7: 43,190,291 I394K possibly damaging Het
Zpr1 G A 9: 46,281,059 D423N probably damaging Het
Other mutations in Pcyox1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01722:Pcyox1 APN 6 86388753 missense probably damaging 1.00
IGL02008:Pcyox1 APN 6 86392268 missense probably benign 0.01
IGL02655:Pcyox1 APN 6 86389344 missense probably damaging 1.00
R0690:Pcyox1 UTSW 6 86394442 missense probably damaging 1.00
R4631:Pcyox1 UTSW 6 86389143 missense probably benign 0.00
R4631:Pcyox1 UTSW 6 86389230 missense possibly damaging 0.96
R4976:Pcyox1 UTSW 6 86388726 missense probably damaging 1.00
R5227:Pcyox1 UTSW 6 86391744 missense probably damaging 0.98
R5288:Pcyox1 UTSW 6 86392354 splice site probably null
R5408:Pcyox1 UTSW 6 86392298 missense probably damaging 1.00
R5862:Pcyox1 UTSW 6 86391674 critical splice donor site probably null
R6002:Pcyox1 UTSW 6 86392182 missense probably benign 0.02
R6123:Pcyox1 UTSW 6 86388928 missense possibly damaging 0.88
R6290:Pcyox1 UTSW 6 86388899 missense probably benign 0.24
R6766:Pcyox1 UTSW 6 86394408 critical splice donor site probably null
R7047:Pcyox1 UTSW 6 86388909 missense probably damaging 1.00
R7066:Pcyox1 UTSW 6 86394496 missense probably damaging 1.00
R7268:Pcyox1 UTSW 6 86391731 missense possibly damaging 0.69
R7445:Pcyox1 UTSW 6 86391679 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- GGCCGACAGATCTTAGATCCAC -3'
(R):5'- AGAAATCACTGGCCTACCTTTC -3'

Sequencing Primer
(F):5'- CCAGAGGCTGAATAGTTACCTCATG -3'
(R):5'- TATCCATGCAAGAGTTACAGGTG -3'
Posted On2019-05-15