Incidental Mutation 'R7139:Cma1'
ID553301
Institutional Source Beutler Lab
Gene Symbol Cma1
Ensembl Gene ENSMUSG00000022225
Gene Namechymase 1, mast cell
SynonymsMcp-5, MMCP-5, Mcpt5, Mcp5
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.082) question?
Stock #R7139 (G1)
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location55941451-55944675 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 55943816 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 44 (H44R)
Ref Sequence ENSEMBL: ENSMUSP00000022834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022834] [ENSMUST00000226280]
Predicted Effect probably damaging
Transcript: ENSMUST00000022834
AA Change: H44R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022834
Gene: ENSMUSG00000022225
AA Change: H44R

DomainStartEndE-ValueType
signal peptide 1 32 N/A INTRINSIC
Tryp_SPc 34 253 4.85e-73 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000226280
AA Change: H31R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a serine protease that belongs to the peptidase family S1. It is expressed in mast cells and is thought to function in the degradation of the extracellular matrix, the regulation of submucosal gland secretion, and the generation of vasoactive peptides. The encoded preproprotein undergoes proteolytic processing to generate a functional enzyme with elastase-like activity. Mice lacking the encoded protein exhibit significant attenuation of ischemia-reperfusion injury of the skeletal muscle. This gene is located in a cluster of related mast cell protease genes on chromosome 14. [provided by RefSeq, Nov 2015]
PHENOTYPE: Mice homozygous for a knock-out allele display a reduction in mast cell-mediated ischemia reperfusion injury of skeletal muscle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2510039O18Rik A G 4: 147,941,838 R272G possibly damaging Het
4930512M02Rik T A 11: 11,590,078 N179Y unknown Het
4930562C15Rik A T 16: 4,850,184 M480L probably benign Het
Abcd4 A G 12: 84,606,298 C377R probably benign Het
Adam23 C A 1: 63,545,577 D381E probably damaging Het
Angpt1 T A 15: 42,676,351 Q37H probably damaging Het
Apeh A T 9: 108,092,146 F260I probably damaging Het
Cadps2 T C 6: 23,410,889 Y681C probably damaging Het
Ccdc162 T C 10: 41,666,721 M386V possibly damaging Het
Celsr2 T C 3: 108,415,359 S46G unknown Het
Cfc1 T C 1: 34,536,479 L78P probably benign Het
Chd7 T C 4: 8,865,865 V2724A probably benign Het
Clca3a1 A T 3: 144,755,302 V196E possibly damaging Het
Cnot2 T C 10: 116,495,019 N394S probably benign Het
Cstf3 A T 2: 104,653,064 I372F possibly damaging Het
Cyb5rl A C 4: 107,071,011 I115L probably benign Het
D5Ertd579e A G 5: 36,613,976 L1025P probably damaging Het
Dmtn T C 14: 70,617,427 N36S probably benign Het
Dnah6 A G 6: 73,135,680 V1647A probably damaging Het
Dock6 T C 9: 21,801,276 Y2063C probably damaging Het
Dst T A 1: 34,299,807 D5149E probably damaging Het
Fancl A G 11: 26,403,358 M85V probably benign Het
Fgd2 T A 17: 29,373,255 F387Y probably damaging Het
Fshr A T 17: 88,986,161 I363N possibly damaging Het
Glce G T 9: 62,070,434 S56* probably null Het
Gm26727 A T 2: 67,433,037 S49T unknown Het
Gm36210 T A 7: 4,899,278 D131V probably damaging Het
Gm5089 T C 14: 122,435,991 D106G unknown Het
Gm5622 G T 14: 51,655,882 E89* probably null Het
Gm9573 TCCTGAGGCAGTGCTGGATACAGGGGTGGTTGGGGTGGGTGAAGAGCCTGAGGCAGTGCTGGAT TCCTGAGGCAGTGCTGGAT 17: 35,622,633 probably benign Het
H2afy2 T A 10: 61,757,895 M1L unknown Het
H2-Eb2 C T 17: 34,334,421 R194W probably benign Het
Hivep1 A T 13: 42,159,954 E1890V probably benign Het
Ighv1-53 A T 12: 115,158,821 C5* probably null Het
Ighv2-5 T A 12: 113,685,599 Y78F probably benign Het
Il9 C T 13: 56,480,613 V88I probably benign Het
Kidins220 A G 12: 24,994,821 T163A probably damaging Het
Lama4 G T 10: 39,075,495 D1079Y probably damaging Het
Lman1l A T 9: 57,615,596 H160Q probably benign Het
Lrrc34 T C 3: 30,624,887 I354V probably benign Het
Mpeg1 A T 19: 12,461,714 T179S probably benign Het
Mrgpra2a A T 7: 47,426,589 L307H probably damaging Het
Mst1 G A 9: 108,082,828 R328H probably damaging Het
Nav3 C A 10: 109,853,477 S313I probably benign Het
Nmt2 T G 2: 3,284,315 S7A probably benign Het
Nsmce1 T C 7: 125,469,082 S197G probably benign Het
Ociad2 A G 5: 73,335,875 V4A probably benign Het
Olfr680-ps1 G T 7: 105,092,798 T7K probably benign Het
Osmr T C 15: 6,821,088 D679G possibly damaging Het
Pappa T A 4: 65,189,450 F699L probably benign Het
Parp8 T A 13: 117,025,266 M40L probably benign Het
Pcyox1 A T 6: 86,394,537 N122K possibly damaging Het
Pkd1l1 T C 11: 8,890,737 S1224G Het
Pkd1l3 T A 8: 109,636,340 S1088T probably damaging Het
Prrt1 T C 17: 34,631,077 V155A probably benign Het
Rbm6 A C 9: 107,853,211 D79E probably damaging Het
Sec31b A T 19: 44,518,936 S819T probably benign Het
Slc22a27 A T 19: 7,926,547 I75N probably damaging Het
Slc25a54 G A 3: 109,098,589 G138R probably damaging Het
Slc6a12 T C 6: 121,365,319 S612P probably benign Het
Slc7a2 A T 8: 40,915,013 I605F probably benign Het
Slit2 A G 5: 48,244,683 T805A probably benign Het
Strbp A T 2: 37,624,502 H308Q probably benign Het
Stxbp4 G A 11: 90,607,009 Q155* probably null Het
Sybu A T 15: 44,677,714 N317K possibly damaging Het
Taok1 G A 11: 77,571,633 S210F probably damaging Het
Tapbp A G 17: 33,920,048 D72G possibly damaging Het
Thbd G T 2: 148,406,541 T469K probably benign Het
Tia1 T C 6: 86,427,688 Y302H possibly damaging Het
Tlr4 T C 4: 66,840,283 F438L probably benign Het
Tmem235 C T 11: 117,860,897 S49L probably damaging Het
Trip4 A G 9: 65,885,221 probably benign Het
Trrap C A 5: 144,803,178 L1137I possibly damaging Het
Vmo1 T C 11: 70,513,848 E109G probably benign Het
Wdfy4 T C 14: 33,151,578 Y258C Het
Wdr91 T G 6: 34,908,263 N121T possibly damaging Het
Zfp39 T C 11: 58,890,559 H459R probably damaging Het
Zfp936 T A 7: 43,190,291 I394K possibly damaging Het
Zpr1 G A 9: 46,281,059 D423N probably damaging Het
Other mutations in Cma1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01070:Cma1 APN 14 55942697 missense probably benign 0.26
IGL02797:Cma1 APN 14 55943814 missense possibly damaging 0.58
R0026:Cma1 UTSW 14 55942164 missense probably damaging 1.00
R2029:Cma1 UTSW 14 55943734 missense possibly damaging 0.81
R2060:Cma1 UTSW 14 55943698 critical splice donor site probably null
R4994:Cma1 UTSW 14 55941671 missense probably damaging 1.00
R5275:Cma1 UTSW 14 55941700 missense probably damaging 1.00
R5794:Cma1 UTSW 14 55944520 missense probably benign
R5824:Cma1 UTSW 14 55941725 missense possibly damaging 0.79
R5955:Cma1 UTSW 14 55943769 missense probably benign 0.20
R5958:Cma1 UTSW 14 55941656 makesense probably null
R6075:Cma1 UTSW 14 55942314 missense probably damaging 0.97
R6139:Cma1 UTSW 14 55942700 critical splice acceptor site probably null
R7088:Cma1 UTSW 14 55943816 missense probably damaging 1.00
R7220:Cma1 UTSW 14 55942663 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATTTGTCAGTTGACCTAGGCTC -3'
(R):5'- AGCTGACAGAGATGCCTGAG -3'

Sequencing Primer
(F):5'- TCAGTTGACCTAGGCTCAGGATC -3'
(R):5'- ATGCCTGAGAGAAGTATGGC -3'
Posted On2019-05-15