Incidental Mutation 'R0601:Slx1b'
ID 55403
Institutional Source Beutler Lab
Gene Symbol Slx1b
Ensembl Gene ENSMUSG00000059772
Gene Name SLX1 structure-specific endonuclease subunit homolog B (S. cerevisiae)
Synonyms 2410170E21Rik, 4833422P03Rik, Giyd2, 1110030E23Rik
MMRRC Submission 038790-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0601 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 126288640-126294956 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 126291812 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Leucine at position 84 (H84L)
Ref Sequence ENSEMBL: ENSMUSP00000118182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000106369] [ENSMUST00000130498] [ENSMUST00000142337] [ENSMUST00000144897]
AlphaFold Q8BX32
Predicted Effect noncoding transcript
Transcript: ENSMUST00000052145
Predicted Effect noncoding transcript
Transcript: ENSMUST00000084586
Predicted Effect probably benign
Transcript: ENSMUST00000106369
SMART Domains Protein: ENSMUSP00000101977
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 10 54 4.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122029
Predicted Effect probably benign
Transcript: ENSMUST00000130498
SMART Domains Protein: ENSMUSP00000114873
Gene: ENSMUSG00000047721

DomainStartEndE-ValueType
Pfam:BolA 12 79 1.2e-23 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000142337
AA Change: I67F
SMART Domains Protein: ENSMUSP00000117927
Gene: ENSMUSG00000059772
AA Change: I67F

DomainStartEndE-ValueType
Pfam:GIY-YIG 10 58 1.5e-10 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144897
AA Change: H84L

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118182
Gene: ENSMUSG00000059772
AA Change: H84L

DomainStartEndE-ValueType
GIYc 10 112 1.14e-3 SMART
low complexity region 152 163 N/A INTRINSIC
low complexity region 194 205 N/A INTRINSIC
low complexity region 214 229 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155012
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144571
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.2%
Validation Efficiency 98% (119/122)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit mouse embryonic fibroblasts that are more sensitive to DNA interstrand corsslinking agents with increased cell death, chromatide breaks, radial structures and impaired resolution of Holliday junctions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 119 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930596D02Rik T G 14: 35,532,146 (GRCm39) D143A probably damaging Het
Abca9 C T 11: 110,007,884 (GRCm39) probably null Het
Abcc5 A G 16: 20,223,309 (GRCm39) probably benign Het
Ablim3 T A 18: 61,982,441 (GRCm39) D168V probably benign Het
Acsl3 C T 1: 78,673,896 (GRCm39) S352F probably damaging Het
Adgrl4 A T 3: 151,204,066 (GRCm39) probably benign Het
Arhgap29 A G 3: 121,784,759 (GRCm39) K229E probably damaging Het
Atad3a A T 4: 155,831,864 (GRCm39) V470D probably damaging Het
Atp8b1 A G 18: 64,704,724 (GRCm39) probably null Het
Bcl2 G A 1: 106,640,292 (GRCm39) R107C probably damaging Het
Bpifa5 A G 2: 154,006,175 (GRCm39) N121S possibly damaging Het
Bpifb4 G A 2: 153,789,203 (GRCm39) probably benign Het
Bptf T A 11: 106,952,518 (GRCm39) T2112S probably benign Het
Btnl4 T C 17: 34,688,285 (GRCm39) K498E probably benign Het
Calhm2 A G 19: 47,129,469 (GRCm39) probably null Het
Capn3 A T 2: 120,333,077 (GRCm39) probably null Het
Caps2 T C 10: 112,031,695 (GRCm39) F265L possibly damaging Het
Casp3 G T 8: 47,089,262 (GRCm39) C170F probably benign Het
Ccdc39 T C 3: 33,873,988 (GRCm39) R615G probably damaging Het
Cd177 A G 7: 24,451,738 (GRCm39) I426T probably benign Het
Cfap53 G A 18: 74,433,221 (GRCm39) R102H possibly damaging Het
Cfhr3 G A 1: 139,521,623 (GRCm39) noncoding transcript Het
Col7a1 T C 9: 108,809,652 (GRCm39) probably benign Het
Cplx3 T C 9: 57,513,357 (GRCm39) E24G possibly damaging Het
Dhx30 A G 9: 109,915,782 (GRCm39) probably null Het
Dnah8 T A 17: 30,927,332 (GRCm39) N1329K probably benign Het
Dnajc11 C G 4: 152,054,393 (GRCm39) R200G probably damaging Het
Dok3 A T 13: 55,672,076 (GRCm39) F201I probably benign Het
Dpf2 A T 19: 5,952,240 (GRCm39) H303Q probably damaging Het
Dtnb A G 12: 3,785,039 (GRCm39) probably benign Het
Dync2i1 T C 12: 116,219,555 (GRCm39) D129G possibly damaging Het
Elk3 T C 10: 93,101,343 (GRCm39) E136G probably damaging Het
Ephb1 T C 9: 102,072,329 (GRCm39) D150G probably damaging Het
Erbb3 A G 10: 128,412,881 (GRCm39) S570P probably benign Het
F2 A T 2: 91,463,656 (GRCm39) probably null Het
Fanca A T 8: 124,035,252 (GRCm39) M231K probably damaging Het
Fbxo34 T C 14: 47,767,714 (GRCm39) V358A probably benign Het
Foxp1 C T 6: 98,907,083 (GRCm39) E666K probably damaging Het
Fto A G 8: 92,128,430 (GRCm39) probably null Het
Gbp2 C T 3: 142,336,519 (GRCm39) R290C possibly damaging Het
Gm57859 T A 11: 113,578,712 (GRCm39) S36T probably benign Het
Grik2 T G 10: 49,298,693 (GRCm39) S343R probably damaging Het
Heatr5b A T 17: 79,075,974 (GRCm39) M1448K probably benign Het
Hmgn3 A T 9: 83,028,482 (GRCm39) probably null Het
Htt T C 5: 35,003,347 (GRCm39) V1274A probably benign Het
Kcnh8 A G 17: 53,201,033 (GRCm39) D489G probably damaging Het
Kcnip3 A T 2: 127,300,317 (GRCm39) probably benign Het
Kdm5a A G 6: 120,379,632 (GRCm39) T647A possibly damaging Het
Krt72 T C 15: 101,694,491 (GRCm39) R135G probably damaging Het
Larp7 T A 3: 127,337,858 (GRCm39) K400N probably damaging Het
Lifr T C 15: 7,198,753 (GRCm39) probably null Het
Lima1 G A 15: 99,678,353 (GRCm39) P696L probably damaging Het
Lrrc8e T G 8: 4,285,239 (GRCm39) probably null Het
Map1a A G 2: 121,129,083 (GRCm39) R116G probably damaging Het
Map3k13 A G 16: 21,723,999 (GRCm39) E327G possibly damaging Het
Med13 A G 11: 86,236,788 (GRCm39) V123A possibly damaging Het
Megf8 A C 7: 25,027,965 (GRCm39) H205P probably benign Het
Met G A 6: 17,555,631 (GRCm39) probably null Het
Mfsd14b A C 13: 65,234,964 (GRCm39) V71G possibly damaging Het
Mpl T A 4: 118,300,733 (GRCm39) T599S probably benign Het
Myh15 A T 16: 48,881,944 (GRCm39) D62V probably damaging Het
Myo5a A G 9: 75,081,297 (GRCm39) T961A probably benign Het
Myrfl A G 10: 116,612,665 (GRCm39) Y895H probably damaging Het
Nap1l1 T C 10: 111,326,224 (GRCm39) probably benign Het
Ncapd3 T A 9: 26,952,803 (GRCm39) Y111N probably benign Het
Nlrc3 A G 16: 3,766,113 (GRCm39) probably benign Het
Nsun2 G T 13: 69,781,361 (GRCm39) V657L probably benign Het
Or10g1b C A 14: 52,627,283 (GRCm39) G316* probably null Het
Or4a74 T A 2: 89,439,564 (GRCm39) N294I probably benign Het
Or4b13 T C 2: 90,083,278 (GRCm39) D18G probably benign Het
Or52d1 A T 7: 103,756,349 (GRCm39) I288F possibly damaging Het
Or52e19 T C 7: 102,959,371 (GRCm39) S148P probably damaging Het
Or5k3 G A 16: 58,970,117 (GRCm39) M301I probably benign Het
Or5m13b A T 2: 85,753,722 (GRCm39) I37F probably benign Het
Or6c68 T A 10: 129,157,885 (GRCm39) M131K possibly damaging Het
Osbpl3 A T 6: 50,276,383 (GRCm39) V795D probably benign Het
Osbpl5 T C 7: 143,263,286 (GRCm39) D155G probably damaging Het
Parm1 G A 5: 91,742,123 (GRCm39) V164I probably benign Het
Pgd A T 4: 149,241,267 (GRCm39) probably benign Het
Pkp1 G A 1: 135,805,920 (GRCm39) R593W probably damaging Het
Polr2l A T 7: 141,053,255 (GRCm39) V53E probably damaging Het
Ppp4c G T 7: 126,386,460 (GRCm39) T29K probably benign Het
Ppp4r4 T A 12: 103,566,779 (GRCm39) probably benign Het
Ptprd A G 4: 76,018,711 (GRCm39) S688P probably benign Het
Rab3b A T 4: 108,747,586 (GRCm39) I28F probably damaging Het
Rnase4 T C 14: 51,342,552 (GRCm39) L92P probably benign Het
Rnpc3 T C 3: 113,413,755 (GRCm39) E229G probably benign Het
Rtraf A T 14: 19,866,274 (GRCm39) D147E possibly damaging Het
Rttn G A 18: 89,061,090 (GRCm39) G1086D probably benign Het
Ryr2 A G 13: 11,720,519 (GRCm39) probably null Het
Sft2d2 T C 1: 165,011,430 (GRCm39) I126V probably benign Het
Skap1 G T 11: 96,614,236 (GRCm39) probably benign Het
Slc14a2 A T 18: 78,200,394 (GRCm39) L753* probably null Het
Slc25a5 G A X: 36,059,408 (GRCm39) A9T probably benign Het
Slc30a5 T C 13: 100,951,278 (GRCm39) probably benign Het
Slc5a4b A C 10: 75,899,870 (GRCm39) I456S possibly damaging Het
Slc9a4 A T 1: 40,642,230 (GRCm39) S400C probably damaging Het
Sptbn1 T C 11: 30,100,008 (GRCm39) Y190C probably damaging Het
Stk32b T C 5: 37,688,910 (GRCm39) Q138R probably damaging Het
Syt6 C A 3: 103,528,206 (GRCm39) D308E probably damaging Het
Sytl2 G A 7: 90,044,374 (GRCm39) D572N probably damaging Het
Taok2 A T 7: 126,478,605 (GRCm39) L109Q probably damaging Het
Tbl1xr1 T C 3: 22,233,483 (GRCm39) probably benign Het
Tlk1 A G 2: 70,544,502 (GRCm39) I711T probably benign Het
Trf A G 9: 103,100,132 (GRCm39) probably null Het
Trpc2 A G 7: 101,733,572 (GRCm39) T548A possibly damaging Het
Ttbk2 A T 2: 120,655,777 (GRCm39) I29N possibly damaging Het
Tti1 A T 2: 157,835,292 (GRCm39) C989S probably damaging Het
Txndc8 A G 4: 58,000,256 (GRCm39) Y108H probably benign Het
Ugt2b1 A T 5: 87,065,539 (GRCm39) V500D possibly damaging Het
Vmn1r34 A G 6: 66,614,648 (GRCm39) I30T possibly damaging Het
Vmn2r115 A G 17: 23,579,074 (GRCm39) K849R probably null Het
Vmn2r76 T A 7: 85,875,323 (GRCm39) probably null Het
Vps13c T A 9: 67,834,754 (GRCm39) S1694R probably benign Het
Wdfy3 G T 5: 101,984,038 (GRCm39) P3509T probably benign Het
Wdr59 GGGTGGTG GGGTG 8: 112,207,172 (GRCm39) probably benign Het
Wnt8b T A 19: 44,482,106 (GRCm39) W40R probably benign Het
Xrra1 A G 7: 99,560,175 (GRCm39) I384V possibly damaging Het
Zfp11 A T 5: 129,734,971 (GRCm39) H163Q probably damaging Het
Other mutations in Slx1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0437:Slx1b UTSW 7 126,291,753 (GRCm39) missense probably benign 0.02
R0714:Slx1b UTSW 7 126,291,620 (GRCm39) missense probably damaging 0.98
R1457:Slx1b UTSW 7 126,291,968 (GRCm39) missense probably damaging 0.98
R3975:Slx1b UTSW 7 126,290,979 (GRCm39) missense probably damaging 1.00
R4757:Slx1b UTSW 7 126,291,701 (GRCm39) missense probably benign
R4950:Slx1b UTSW 7 126,290,939 (GRCm39) utr 3 prime probably benign
R6194:Slx1b UTSW 7 126,291,503 (GRCm39) missense possibly damaging 0.80
R7334:Slx1b UTSW 7 126,291,699 (GRCm39) missense probably damaging 0.99
R9664:Slx1b UTSW 7 126,291,698 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACACAGACTGCATCTGGCCTTG -3'
(R):5'- GGGACATGGTGCTGATCATACACG -3'

Sequencing Primer
(F):5'- TGTCAGCCTCGCTTACAG -3'
(R):5'- GTGCTGATCATACACGGTTTC -3'
Posted On 2013-07-11