Mutagenetix > Incidental Mutations

Incidental Mutation 'R0601:Myo5a'

55416

Institutional Source

Beutler Lab

Gene Symbol

Myo5a

Ensembl Gene

ENSMUSG00000034593

Gene Name

myosin VA

Synonyms

9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA

MMRRC Submission

038790-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R0601 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

75071015-75223688 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75174015 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 961 (T961A)

Ref Sequence

ENSEMBL: ENSMUSP00000116028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000123531] [ENSMUST00000136731] [ENSMUST00000155282]

PDB Structure

Structure of apo-calmodulin bound to unconventional myosin V [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD [X-RAY DIFFRACTION]
Crystal Structure of MyoVa-GTD in Complex with Two Cargos [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000123128
AA Change: T961A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: T961A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1364	N/A	INTRINSIC
coiled coil region	1406	1443	N/A	INTRINSIC
DIL	1685	1790	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000123531

Predicted Effect

probably benign
Transcript: ENSMUST00000136731
AA Change: T961A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: T961A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1314	1418	N/A	INTRINSIC
DIL	1660	1765	2.47e-51	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000155282
AA Change: T961A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: T961A

Domain	Start	End	E-Value	Type
MYSc	63	764	N/A	SMART
IQ	765	787	3.65e-4	SMART
IQ	788	810	1.56e-3	SMART
IQ	813	835	3.05e-6	SMART
IQ	836	858	8.38e-4	SMART
IQ	861	883	1.09e-2	SMART
IQ	884	906	6.97e0	SMART
coiled coil region	1153	1234	N/A	INTRINSIC
coiled coil region	1339	1445	N/A	INTRINSIC
DIL	1687	1792	2.47e-51	SMART

Meta Mutation Damage Score

0.0597

Coding Region Coverage

1x: 99.4%
3x: 98.9%
10x: 97.6%
20x: 95.2%

Validation Efficiency

98% (119/122)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 119 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4930596D02Rik	T	G	14: 35,810,189	D143A	probably damaging	Het
Abca9	C	T	11: 110,117,058		probably null	Het
Abcc5	A	G	16: 20,404,559		probably benign	Het
Ablim3	T	A	18: 61,849,370	D168V	probably benign	Het
Acsl3	C	T	1: 78,696,179	S352F	probably damaging	Het
Adgrl4	A	T	3: 151,498,429		probably benign	Het
Arhgap29	A	G	3: 121,991,110	K229E	probably damaging	Het
Atad3a	A	T	4: 155,747,407	V470D	probably damaging	Het
Atp8b1	A	G	18: 64,571,653		probably null	Het
Bcl2	G	A	1: 106,712,562	R107C	probably damaging	Het
Bpifa5	A	G	2: 154,164,255	N121S	possibly damaging	Het
Bpifb4	G	A	2: 153,947,283		probably benign	Het
Bptf	T	A	11: 107,061,692	T2112S	probably benign	Het
Btnl4	T	C	17: 34,469,311	K498E	probably benign	Het
Calhm2	A	G	19: 47,141,030		probably null	Het
Capn3	A	T	2: 120,502,596		probably null	Het
Caps2	T	C	10: 112,195,790	F265L	possibly damaging	Het
Casp3	G	T	8: 46,636,227	C170F	probably benign	Het
Ccdc39	T	C	3: 33,819,839	R615G	probably damaging	Het
Cd177	A	G	7: 24,752,313	I426T	probably benign	Het
Cfap53	G	A	18: 74,300,150	R102H	possibly damaging	Het
Cfhr3	G	A	1: 139,593,885		noncoding transcript	Het
Col7a1	T	C	9: 108,980,584		probably benign	Het
Cplx3	T	C	9: 57,606,074	E24G	possibly damaging	Het
D11Wsu47e	T	A	11: 113,687,886	S36T	probably benign	Het
Dhx30	A	G	9: 110,086,714		probably null	Het
Dnah8	T	A	17: 30,708,358	N1329K	probably benign	Het
Dnajc11	C	G	4: 151,969,936	R200G	probably damaging	Het
Dok3	A	T	13: 55,524,263	F201I	probably benign	Het
Dpf2	A	T	19: 5,902,212	H303Q	probably damaging	Het
Dtnb	A	G	12: 3,735,039		probably benign	Het
Elk3	T	C	10: 93,265,481	E136G	probably damaging	Het
Ephb1	T	C	9: 102,195,130	D150G	probably damaging	Het
Erbb3	A	G	10: 128,577,012	S570P	probably benign	Het
F2	A	T	2: 91,633,311		probably null	Het
Fanca	A	T	8: 123,308,513	M231K	probably damaging	Het
Fbxo34	T	C	14: 47,530,257	V358A	probably benign	Het
Foxp1	C	T	6: 98,930,122	E666K	probably damaging	Het
Fto	A	G	8: 91,401,802		probably null	Het
Gbp2	C	T	3: 142,630,758	R290C	possibly damaging	Het
Grik2	T	G	10: 49,422,597	S343R	probably damaging	Het
Heatr5b	A	T	17: 78,768,545	M1448K	probably benign	Het
Hmgn3	A	T	9: 83,146,429		probably null	Het
Htt	T	C	5: 34,846,003	V1274A	probably benign	Het
Kcnh8	A	G	17: 52,894,005	D489G	probably damaging	Het
Kcnip3	A	T	2: 127,458,397		probably benign	Het
Kdm5a	A	G	6: 120,402,671	T647A	possibly damaging	Het
Krt72	T	C	15: 101,786,056	R135G	probably damaging	Het
Larp7	T	A	3: 127,544,209	K400N	probably damaging	Het
Lifr	T	C	15: 7,169,272		probably null	Het
Lima1	G	A	15: 99,780,472	P696L	probably damaging	Het
Lrrc8e	T	G	8: 4,235,239		probably null	Het
Map1a	A	G	2: 121,298,602	R116G	probably damaging	Het
Map3k13	A	G	16: 21,905,249	E327G	possibly damaging	Het
Med13	A	G	11: 86,345,962	V123A	possibly damaging	Het
Megf8	A	C	7: 25,328,540	H205P	probably benign	Het
Met	G	A	6: 17,555,632		probably null	Het
Mfsd14b	A	C	13: 65,087,150	V71G	possibly damaging	Het
Mpl	T	A	4: 118,443,536	T599S	probably benign	Het
Myh15	A	T	16: 49,061,581	D62V	probably damaging	Het
Myrfl	A	G	10: 116,776,760	Y895H	probably damaging	Het
Nap1l1	T	C	10: 111,490,363		probably benign	Het
Ncapd3	T	A	9: 27,041,507	Y111N	probably benign	Het
Nlrc3	A	G	16: 3,948,249		probably benign	Het
Nsun2	G	T	13: 69,633,242	V657L	probably benign	Het
Olfr1026	A	T	2: 85,923,378	I37F	probably benign	Het
Olfr1247	T	A	2: 89,609,220	N294I	probably benign	Het
Olfr142	T	C	2: 90,252,934	D18G	probably benign	Het
Olfr1511	C	A	14: 52,389,826	G316*	probably null	Het
Olfr195	G	A	16: 59,149,754	M301I	probably benign	Het
Olfr596	T	C	7: 103,310,164	S148P	probably damaging	Het
Olfr646	A	T	7: 104,107,142	I288F	possibly damaging	Het
Olfr780	T	A	10: 129,322,016	M131K	possibly damaging	Het
Osbpl3	A	T	6: 50,299,403	V795D	probably benign	Het
Osbpl5	T	C	7: 143,709,549	D155G	probably damaging	Het
Parm1	G	A	5: 91,594,264	V164I	probably benign	Het
Pgd	A	T	4: 149,156,810		probably benign	Het
Pkp1	G	A	1: 135,878,182	R593W	probably damaging	Het
Polr2l	A	T	7: 141,473,342	V53E	probably damaging	Het
Ppp4c	G	T	7: 126,787,288	T29K	probably benign	Het
Ppp4r4	T	A	12: 103,600,520		probably benign	Het
Ptprd	A	G	4: 76,100,474	S688P	probably benign	Het
Rab3b	A	T	4: 108,890,389	I28F	probably damaging	Het
Rnase4	T	C	14: 51,105,095	L92P	probably benign	Het
Rnpc3	T	C	3: 113,620,106	E229G	probably benign	Het
Rtraf	A	T	14: 19,816,206	D147E	possibly damaging	Het
Rttn	G	A	18: 89,042,966	G1086D	probably benign	Het
Ryr2	A	G	13: 11,705,633		probably null	Het
Sft2d2	T	C	1: 165,183,861	I126V	probably benign	Het
Skap1	G	T	11: 96,723,410		probably benign	Het
Slc14a2	A	T	18: 78,157,179	L753*	probably null	Het
Slc25a5	G	A	X: 36,795,755	A9T	probably benign	Het
Slc30a5	T	C	13: 100,814,770		probably benign	Het
Slc5a4b	A	C	10: 76,064,036	I456S	possibly damaging	Het
Slc9a4	A	T	1: 40,603,070	S400C	probably damaging	Het
Slx1b	T	A	7: 126,692,640	H84L	probably damaging	Het
Sptbn1	T	C	11: 30,150,008	Y190C	probably damaging	Het
Stk32b	T	C	5: 37,531,566	Q138R	probably damaging	Het
Syt6	C	A	3: 103,620,890	D308E	probably damaging	Het
Sytl2	G	A	7: 90,395,166	D572N	probably damaging	Het
Taok2	A	T	7: 126,879,433	L109Q	probably damaging	Het
Tbl1xr1	T	C	3: 22,179,319		probably benign	Het
Tlk1	A	G	2: 70,714,158	I711T	probably benign	Het
Trf	A	G	9: 103,222,933		probably null	Het
Trpc2	A	G	7: 102,084,365	T548A	possibly damaging	Het
Ttbk2	A	T	2: 120,825,296	I29N	possibly damaging	Het
Tti1	A	T	2: 157,993,372	C989S	probably damaging	Het
Txndc8	A	G	4: 58,000,256	Y108H	probably benign	Het
Ugt2b1	A	T	5: 86,917,680	V500D	possibly damaging	Het
Vmn1r34	A	G	6: 66,637,664	I30T	possibly damaging	Het
Vmn2r115	A	G	17: 23,360,100	K849R	probably null	Het
Vmn2r76	T	A	7: 86,226,115		probably null	Het
Vps13c	T	A	9: 67,927,472	S1694R	probably benign	Het
Wdfy3	G	T	5: 101,836,172	P3509T	probably benign	Het
Wdr59	GGGTGGTG	GGGTG	8: 111,480,540		probably benign	Het
Wdr60	T	C	12: 116,255,935	D129G	possibly damaging	Het
Wnt8b	T	A	19: 44,493,667	W40R	probably benign	Het
Xrra1	A	G	7: 99,910,968	I384V	possibly damaging	Het
Zfp11	A	T	5: 129,657,907	H163Q	probably damaging	Het

Other mutations in Myo5a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00090:Myo5a	APN	9	75161497	nonsense	probably null
IGL00547:Myo5a	APN	9	75141453	missense	probably benign	0.00
IGL00788:Myo5a	APN	9	75168959	missense	probably benign	0.15
IGL01327:Myo5a	APN	9	75187538	splice site	probably benign
IGL01687:Myo5a	APN	9	75156249	missense	probably benign	0.12
IGL01886:Myo5a	APN	9	75169090	splice site	probably benign
IGL01945:Myo5a	APN	9	75140671	missense	probably damaging	1.00
IGL02127:Myo5a	APN	9	75212981	missense	probably benign	0.12
IGL02137:Myo5a	APN	9	75161535	splice site	probably null
IGL02183:Myo5a	APN	9	75167236	splice site	probably benign
IGL02427:Myo5a	APN	9	75176618	splice site	probably benign
IGL02490:Myo5a	APN	9	75136455	missense	probably damaging	1.00
IGL02574:Myo5a	APN	9	75211147	missense	probably benign	0.00
IGL02886:Myo5a	APN	9	75151887	splice site	probably benign
IGL02961:Myo5a	APN	9	75215120	missense	probably benign	0.04
IGL03090:Myo5a	APN	9	75120833	missense	probably damaging	1.00
IGL03119:Myo5a	APN	9	75174015	missense	probably benign	0.01
IGL03237:Myo5a	APN	9	75129994	missense	probably damaging	1.00
IGL03296:Myo5a	APN	9	75116202	missense	probably damaging	1.00
naoki	UTSW	9	75161492	missense	probably damaging	1.00
new_gray	UTSW	9		missense
nut	UTSW	9		splice donor site
silver_decerebrate	UTSW	9	75164195	missense	probably damaging	1.00
silver_decerebrate_2	UTSW	9	75211127	missense	probably damaging	1.00
IGL02988:Myo5a	UTSW	9	75130141	splice site	probably benign
IGL03050:Myo5a	UTSW	9	75146909	splice site	probably null
PIT4403001:Myo5a	UTSW	9	75217523	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0047:Myo5a	UTSW	9	75156207	missense	probably damaging	1.00
R0091:Myo5a	UTSW	9	75161492	missense	probably damaging	1.00
R0142:Myo5a	UTSW	9	75160574	missense	probably benign	0.01
R0243:Myo5a	UTSW	9	75186123	critical splice donor site	probably null
R0395:Myo5a	UTSW	9	75193977	missense	probably benign	0.39
R0427:Myo5a	UTSW	9	75174196	missense	probably benign	0.00
R0545:Myo5a	UTSW	9	75167037	missense	possibly damaging	0.94
R0565:Myo5a	UTSW	9	75180112	missense	probably benign	0.00
R1457:Myo5a	UTSW	9	75213065	missense	probably damaging	0.99
R1510:Myo5a	UTSW	9	75171551	missense	probably benign
R1548:Myo5a	UTSW	9	75171746	missense	probably damaging	1.00
R1759:Myo5a	UTSW	9	75181993	missense	possibly damaging	0.72
R1924:Myo5a	UTSW	9	75116207	missense	probably damaging	1.00
R1960:Myo5a	UTSW	9	75147857	missense	probably damaging	1.00
R2050:Myo5a	UTSW	9	75146874	missense	probably benign	0.01
R2070:Myo5a	UTSW	9	75181984	missense	probably benign	0.03
R2075:Myo5a	UTSW	9	75189918	missense	probably benign	0.01
R2148:Myo5a	UTSW	9	75180147	missense	probably damaging	1.00
R2201:Myo5a	UTSW	9	75217943	missense	possibly damaging	0.51
R2337:Myo5a	UTSW	9	75203801	missense	probably damaging	1.00
R2357:Myo5a	UTSW	9	75201365	missense	probably damaging	0.99
R2392:Myo5a	UTSW	9	75209239	missense	probably benign	0.02
R2432:Myo5a	UTSW	9	75212873	missense	possibly damaging	0.89
R2568:Myo5a	UTSW	9	75123040	missense	probably damaging	1.00
R2568:Myo5a	UTSW	9	75151897	missense	probably damaging	1.00
R2932:Myo5a	UTSW	9	75196136	missense	possibly damaging	0.85
R2971:Myo5a	UTSW	9	75116202	missense	probably damaging	1.00
R4231:Myo5a	UTSW	9	75189997	missense	possibly damaging	0.67
R4293:Myo5a	UTSW	9	75144171	missense	probably benign
R4321:Myo5a	UTSW	9	75217530	missense	probably damaging	0.99
R4450:Myo5a	UTSW	9	75167176	missense	probably benign	0.00
R4573:Myo5a	UTSW	9	75201297	splice site	probably null
R4577:Myo5a	UTSW	9	75217545	missense	probably damaging	1.00
R4601:Myo5a	UTSW	9	75136388	missense	probably damaging	1.00
R4690:Myo5a	UTSW	9	75153823	missense	probably damaging	0.99
R4691:Myo5a	UTSW	9	75180156	missense	probably damaging	0.99
R4764:Myo5a	UTSW	9	75116336	intron	probably benign
R4767:Myo5a	UTSW	9	75144076	missense	probably damaging	0.99
R4811:Myo5a	UTSW	9	75141543	critical splice donor site	probably null
R4829:Myo5a	UTSW	9	75136407	missense	probably damaging	1.00
R4863:Myo5a	UTSW	9	75217507	missense	probably damaging	1.00
R4902:Myo5a	UTSW	9	75174078	missense	probably benign
R4947:Myo5a	UTSW	9	75123048	missense	probably damaging	1.00
R5074:Myo5a	UTSW	9	75174156	missense	probably benign
R5095:Myo5a	UTSW	9	75152020	missense	probably damaging	1.00
R5095:Myo5a	UTSW	9	75184389	nonsense	probably null
R5254:Myo5a	UTSW	9	75130120	missense	probably damaging	1.00
R5267:Myo5a	UTSW	9	75152010	missense	probably damaging	1.00
R5419:Myo5a	UTSW	9	75147897	missense	probably damaging	1.00
R5514:Myo5a	UTSW	9	75153766	missense	probably damaging	1.00
R5629:Myo5a	UTSW	9	75203845	missense	possibly damaging	0.89
R5649:Myo5a	UTSW	9	75171719	missense	possibly damaging	0.92
R5661:Myo5a	UTSW	9	75167206	missense	probably benign	0.02
R5665:Myo5a	UTSW	9	75144181	critical splice donor site	probably null
R5719:Myo5a	UTSW	9	75151931	missense	probably damaging	1.00
R5964:Myo5a	UTSW	9	75203833	missense	probably benign	0.09
R6014:Myo5a	UTSW	9	75167207	nonsense	probably null
R6344:Myo5a	UTSW	9	75160509	missense	probably benign	0.09
R6345:Myo5a	UTSW	9	75189913	missense	possibly damaging	0.77
R6644:Myo5a	UTSW	9	75146967	missense	probably damaging	0.98
R6712:Myo5a	UTSW	9	75212900	missense	probably benign	0.12
R6838:Myo5a	UTSW	9	75153883	critical splice donor site	probably null
R6866:Myo5a	UTSW	9	75140688	missense	probably damaging	1.00
R6876:Myo5a	UTSW	9	75160490	missense	probably benign	0.04
R7108:Myo5a	UTSW	9	75129992	missense	probably damaging	1.00
R7159:Myo5a	UTSW	9	75171563	missense	probably benign	0.07
R7164:Myo5a	UTSW	9	75180153	missense	probably benign	0.00
R7219:Myo5a	UTSW	9	75120770	missense	probably damaging	1.00
R7497:Myo5a	UTSW	9	75197701	missense
R7620:Myo5a	UTSW	9	75164136	missense	probably benign	0.41
R7719:Myo5a	UTSW	9	75144084	missense	probably benign	0.01
R7810:Myo5a	UTSW	9	75160465	missense	probably benign	0.09
R7810:Myo5a	UTSW	9	75169010	missense	probably benign
R7866:Myo5a	UTSW	9	75203752	missense	probably damaging	1.00
R7939:Myo5a	UTSW	9	75189900	missense
R8050:Myo5a	UTSW	9	75181946	missense	probably damaging	0.99
R8061:Myo5a	UTSW	9	75122957	nonsense	probably null
R8326:Myo5a	UTSW	9	75217989	missense	probably damaging	0.98
R8529:Myo5a	UTSW	9	75212872	missense	probably benign	0.02
R8824:Myo5a	UTSW	9	75167046	missense	probably damaging	1.00
R8858:Myo5a	UTSW	9	75184683	missense	probably damaging	0.99
X0010:Myo5a	UTSW	9	75185905	missense	probably damaging	1.00
Z1177:Myo5a	UTSW	9	75186036	missense

Predicted Primers

PCR Primer
(F):5'- TGGCCTCTCGATGCTATGATGATGT -3'
(R):5'- ACTTGGACTAGGTCAGGACTACAGTG -3'

Sequencing Primer
(F):5'- caggcagaagcaggtgg -3'
(R):5'- GACTAGGTCAGGACTACAGTGTTTAC -3'

Posted On

2013-07-11