Incidental Mutation 'R0603:Uba2'
ID55548
Institutional Source Beutler Lab
Gene Symbol Uba2
Ensembl Gene ENSMUSG00000052997
Gene Nameubiquitin-like modifier activating enzyme 2
SynonymsUble1b, Sumo-1 activating enzyme subunit 2, anthracycline-associated resistance, Arx, UBA2, SAE2
MMRRC Submission 038792-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0603 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location34140688-34169599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 34161613 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 5 (M5K)
Ref Sequence ENSEMBL: ENSMUSP00000135885 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102746] [ENSMUST00000156253] [ENSMUST00000175991]
Predicted Effect probably benign
Transcript: ENSMUST00000102746
AA Change: M128K

PolyPhen 2 Score 0.362 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000099807
Gene: ENSMUSG00000052997
AA Change: M128K

DomainStartEndE-ValueType
Pfam:ThiF 3 442 5.8e-77 PFAM
Pfam:UAE_UbL 450 537 5.6e-27 PFAM
Pfam:UBA2_C 547 634 8.9e-30 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000134856
AA Change: M41K
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139916
Predicted Effect probably damaging
Transcript: ENSMUST00000156253
AA Change: M106K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116605
Gene: ENSMUSG00000052997
AA Change: M106K

DomainStartEndE-ValueType
Pfam:ThiF 10 119 1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000175991
AA Change: M5K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000135885
Gene: ENSMUSG00000052997
AA Change: M5K

DomainStartEndE-ValueType
Pfam:UBA_e1_thiolCys 31 75 5.3e-26 PFAM
low complexity region 88 105 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206651
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.9%
  • 10x: 97.6%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 (MIM 613294) and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc7 A G 5: 122,440,170 N406S probably benign Het
Arhgap4 C T X: 73,906,783 R54Q probably damaging Het
Asb15 T A 6: 24,556,557 I17N probably damaging Het
Atp8a1 T C 5: 67,756,696 probably null Het
Caprin1 A G 2: 103,796,801 V47A probably benign Het
Col4a2 T C 8: 11,414,779 V348A probably benign Het
Disp2 A G 2: 118,792,006 K1073R probably damaging Het
Dmxl2 G A 9: 54,405,906 H1686Y possibly damaging Het
Dzank1 C T 2: 144,511,512 V152I probably benign Het
Evl T A 12: 108,648,422 I25N probably damaging Het
Fam117a A G 11: 95,380,873 K424E probably damaging Het
Gm17732 C T 18: 62,662,752 probably benign Het
Gpr158 T C 2: 21,815,669 I659T possibly damaging Het
Hectd4 T A 5: 121,304,337 V1280E possibly damaging Het
Ikbkap A T 4: 56,792,105 I221N possibly damaging Het
Irs4 T C X: 141,725,075 T42A probably damaging Het
Kdm4a C T 4: 118,142,511 V905I probably damaging Het
Lmtk3 T A 7: 45,795,556 probably benign Het
Lsp1 G A 7: 142,489,378 R221H probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Mut A T 17: 40,947,166 I408F probably damaging Het
Nckap1 A T 2: 80,512,729 V942E probably benign Het
Neto1 T A 18: 86,473,660 C229S possibly damaging Het
Nipal2 A G 15: 34,650,398 I63T probably damaging Het
Olfr1299 A T 2: 111,664,880 Y218F probably damaging Het
Olfr366 G A 2: 37,220,106 V206I probably damaging Het
Olfr58 A T 9: 19,783,939 R269W probably damaging Het
Olfr744 T C 14: 50,618,510 I96T probably damaging Het
Olfr957 C A 9: 39,511,514 V69F possibly damaging Het
Pgpep1 T C 8: 70,650,633 E120G probably benign Het
Pkhd1 A T 1: 20,117,173 M3637K probably benign Het
Pkm T C 9: 59,665,881 V58A probably damaging Het
Ppp2r1b C A 9: 50,861,685 T154K probably damaging Het
Rgs18 T A 1: 144,756,080 D98V possibly damaging Het
Rsph6a G T 7: 19,065,961 A506S possibly damaging Het
Selenop T A 15: 3,275,701 V113E probably damaging Het
Slc6a11 G A 6: 114,244,890 V514M probably benign Het
Srsf9 C T 5: 115,332,637 S132L probably damaging Het
Tchh G A 3: 93,443,781 R176H possibly damaging Het
Tcp11 T C 17: 28,067,810 N405S probably damaging Het
Tle1 A C 4: 72,118,347 D760E probably damaging Het
Tmem178 A G 17: 80,945,059 D124G possibly damaging Het
Trabd G A 15: 89,082,726 E118K probably damaging Het
Ttc39a A G 4: 109,426,302 D115G probably damaging Het
Uaca T A 9: 60,871,097 M920K possibly damaging Het
Unc5c C T 3: 141,771,102 P343L probably damaging Het
Wdhd1 T C 14: 47,263,586 D453G probably damaging Het
Wfdc8 A G 2: 164,603,225 Y157H probably damaging Het
Zbbx T G 3: 75,078,450 K432Q probably benign Het
Zeb2 G A 2: 45,017,426 T169M probably benign Het
Zfp956 A G 6: 47,956,028 E79G probably damaging Het
Zzef1 G A 11: 72,818,069 V165I probably benign Het
Other mutations in Uba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Uba2 APN 7 34158869 missense probably damaging 1.00
IGL01593:Uba2 APN 7 34146264 missense probably damaging 0.96
IGL02268:Uba2 APN 7 34142736 critical splice donor site probably null
IGL03399:Uba2 APN 7 34144514 missense probably damaging 1.00
Minus UTSW 7 34146262 nonsense probably null
Subtracted UTSW 7 34150814 missense possibly damaging 0.65
R0242:Uba2 UTSW 7 34154629 missense possibly damaging 0.92
R0242:Uba2 UTSW 7 34154629 missense possibly damaging 0.92
R0270:Uba2 UTSW 7 34150856 missense possibly damaging 0.95
R0390:Uba2 UTSW 7 34151021 missense probably benign 0.10
R1066:Uba2 UTSW 7 34158822 missense probably damaging 1.00
R1806:Uba2 UTSW 7 34163199 missense probably damaging 0.99
R1813:Uba2 UTSW 7 34151030 missense probably damaging 1.00
R1896:Uba2 UTSW 7 34151030 missense probably damaging 1.00
R2210:Uba2 UTSW 7 34163162 missense probably damaging 1.00
R3618:Uba2 UTSW 7 34154482 critical splice donor site probably null
R3779:Uba2 UTSW 7 34154646 critical splice acceptor site probably null
R3793:Uba2 UTSW 7 34146297 missense probably damaging 0.97
R4607:Uba2 UTSW 7 34154596 missense probably damaging 1.00
R4608:Uba2 UTSW 7 34154596 missense probably damaging 1.00
R5938:Uba2 UTSW 7 34165490 splice site probably null
R6404:Uba2 UTSW 7 34154560 missense probably damaging 0.98
R7050:Uba2 UTSW 7 34146262 nonsense probably null
R7181:Uba2 UTSW 7 34141429 missense probably benign 0.01
R7369:Uba2 UTSW 7 34150814 missense possibly damaging 0.65
R7622:Uba2 UTSW 7 34165435 missense probably damaging 1.00
R7727:Uba2 UTSW 7 34150850 missense probably damaging 0.99
R7807:Uba2 UTSW 7 34163213 missense possibly damaging 0.91
R8038:Uba2 UTSW 7 34147597 missense probably damaging 1.00
R8057:Uba2 UTSW 7 34168410 missense possibly damaging 0.80
X0026:Uba2 UTSW 7 34154479 splice site probably null
Predicted Primers PCR Primer
(F):5'- CATGCAGAGTCAATCGCTCTCTTCC -3'
(R):5'- CCCTAACAGGCAGAAGTGGTCAAG -3'

Sequencing Primer
(F):5'- TGGCATGAAATCTCTACACCTGAG -3'
(R):5'- GCAGAAGTGGTCAAGTTACATTCC -3'
Posted On2013-07-11