Incidental Mutation 'R8253:Uba2'
ID640129
Institutional Source Beutler Lab
Gene Symbol Uba2
Ensembl Gene ENSMUSG00000052997
Gene Nameubiquitin-like modifier activating enzyme 2
SynonymsUble1b, Sumo-1 activating enzyme subunit 2, anthracycline-associated resistance, Arx, UBA2, SAE2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8253 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location34140688-34169599 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34150898 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 377 (M377V)
Ref Sequence ENSEMBL: ENSMUSP00000099807 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102746] [ENSMUST00000175991]
Predicted Effect probably damaging
Transcript: ENSMUST00000102746
AA Change: M377V

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000099807
Gene: ENSMUSG00000052997
AA Change: M377V

DomainStartEndE-ValueType
Pfam:ThiF 3 442 5.8e-77 PFAM
Pfam:UAE_UbL 450 537 5.6e-27 PFAM
Pfam:UBA2_C 547 634 8.9e-30 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134856
Predicted Effect probably benign
Transcript: ENSMUST00000175991
SMART Domains Protein: ENSMUSP00000135885
Gene: ENSMUSG00000052997

DomainStartEndE-ValueType
Pfam:UBA_e1_thiolCys 31 75 5.3e-26 PFAM
low complexity region 88 105 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Posttranslational modification of proteins by the addition of the small protein SUMO (see SUMO1; MIM 601912), or sumoylation, regulates protein structure and intracellular localization. SAE1 (MIM 613294) and UBA2 form a heterodimer that functions as a SUMO-activating enzyme for the sumoylation of proteins (Okuma et al., 1999 [PubMed 9920803]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Afap1l1 T C 18: 61,741,631 E493G probably benign Het
Akr1a1 A T 4: 116,636,643 D313E probably damaging Het
Ap1m1 T A 8: 72,252,886 V242E probably damaging Het
Atad2b T A 12: 4,974,159 S670T possibly damaging Het
Atad2b C T 12: 4,974,160 S670L probably benign Het
Avpr1b A T 1: 131,609,416 T313S probably benign Het
Cblc A G 7: 19,786,232 I362T probably damaging Het
Ccdc171 T A 4: 83,742,970 S1106T probably damaging Het
Csde1 C A 3: 103,038,721 N10K probably damaging Het
Csnk2a2 T C 8: 95,488,377 Y24C Het
Cyb5r4 G T 9: 87,059,055 L420F probably damaging Het
Cyth4 A G 15: 78,602,737 I22V probably benign Het
Dnah8 CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT CGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTTTGACTTTCCTGTGTCTTCAATATTTTGTTCCCTTTCCCGTAGGTGCCGTCCTT 17: 30,760,867 probably null Het
Dner C T 1: 84,534,877 G323E probably damaging Het
Elf1 T C 14: 79,536,352 M1T probably null Het
Fam13c T C 10: 70,553,203 S520P probably damaging Het
Fam160a2 T A 7: 105,379,087 H885L possibly damaging Het
Gabra2 A G 5: 71,092,070 I30T probably benign Het
Gm6793 T A 8: 112,015,008 M1L probably benign Het
Inpp5a T C 7: 139,481,640 L76P probably damaging Het
Itih5 T C 2: 10,238,595 I381T probably benign Het
Lyrm7 T C 11: 54,850,401 I36V probably null Het
Magi2 A G 5: 20,609,307 I906V probably benign Het
Mup5 C T 4: 61,834,574 A71T probably benign Het
Ndufaf6 G A 4: 11,059,086 R248W probably damaging Het
Olfr469 A G 7: 107,822,569 I300T probably damaging Het
Olfr619 A T 7: 103,604,331 I226L possibly damaging Het
Palm A T 10: 79,807,677 K80* probably null Het
Pcyox1 C T 6: 86,389,062 R390K probably benign Het
Pdx1 T C 5: 147,270,649 probably null Het
Pifo T C 3: 105,998,367 M193V probably benign Het
Pkp2 T A 16: 16,268,542 V689D probably damaging Het
Prkar2a G T 9: 108,740,439 R232L probably damaging Het
Rasgrp4 C T 7: 29,138,862 T87M possibly damaging Het
Ryr2 T A 13: 11,827,553 Q486L possibly damaging Het
Shd T C 17: 55,976,295 V309A Het
Skint7 C T 4: 111,977,478 Q20* probably null Het
Slc35g1 C A 19: 38,402,789 T173K probably damaging Het
Slit2 T C 5: 48,275,671 F1073L probably benign Het
Snx18 T A 13: 113,594,781 D559V probably damaging Het
Tbr1 G T 2: 61,805,241 Q178H probably benign Het
Tmem145 T G 7: 25,307,514 Y114D probably damaging Het
Ttc22 T C 4: 106,638,520 L357P probably damaging Het
Vps13c T A 9: 67,943,488 Y2242* probably null Het
Xdh T G 17: 73,918,382 Q475P possibly damaging Het
Xrcc6bp1 C T 10: 126,868,674 G197S probably benign Het
Zbtb42 T G 12: 112,680,312 L307R probably damaging Het
Other mutations in Uba2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00704:Uba2 APN 7 34158869 missense probably damaging 1.00
IGL01593:Uba2 APN 7 34146264 missense probably damaging 0.96
IGL02268:Uba2 APN 7 34142736 critical splice donor site probably null
IGL03399:Uba2 APN 7 34144514 missense probably damaging 1.00
Minus UTSW 7 34146262 nonsense probably null
Subtracted UTSW 7 34150814 missense possibly damaging 0.65
R0242:Uba2 UTSW 7 34154629 missense possibly damaging 0.92
R0242:Uba2 UTSW 7 34154629 missense possibly damaging 0.92
R0270:Uba2 UTSW 7 34150856 missense possibly damaging 0.95
R0390:Uba2 UTSW 7 34151021 missense probably benign 0.10
R0603:Uba2 UTSW 7 34161613 missense probably damaging 1.00
R1066:Uba2 UTSW 7 34158822 missense probably damaging 1.00
R1806:Uba2 UTSW 7 34163199 missense probably damaging 0.99
R1813:Uba2 UTSW 7 34151030 missense probably damaging 1.00
R1896:Uba2 UTSW 7 34151030 missense probably damaging 1.00
R2210:Uba2 UTSW 7 34163162 missense probably damaging 1.00
R3618:Uba2 UTSW 7 34154482 critical splice donor site probably null
R3779:Uba2 UTSW 7 34154646 critical splice acceptor site probably null
R3793:Uba2 UTSW 7 34146297 missense probably damaging 0.97
R4607:Uba2 UTSW 7 34154596 missense probably damaging 1.00
R4608:Uba2 UTSW 7 34154596 missense probably damaging 1.00
R5938:Uba2 UTSW 7 34165490 splice site probably null
R6404:Uba2 UTSW 7 34154560 missense probably damaging 0.98
R7050:Uba2 UTSW 7 34146262 nonsense probably null
R7181:Uba2 UTSW 7 34141429 missense probably benign 0.01
R7369:Uba2 UTSW 7 34150814 missense possibly damaging 0.65
R7622:Uba2 UTSW 7 34165435 missense probably damaging 1.00
R7727:Uba2 UTSW 7 34150850 missense probably damaging 0.99
R7807:Uba2 UTSW 7 34163213 missense possibly damaging 0.91
R8038:Uba2 UTSW 7 34147597 missense probably damaging 1.00
R8057:Uba2 UTSW 7 34168410 missense possibly damaging 0.80
R8120:Uba2 UTSW 7 34168387 missense probably benign
X0026:Uba2 UTSW 7 34154479 splice site probably null
Predicted Primers PCR Primer
(F):5'- TGAGAGCTGCACACTCTCAG -3'
(R):5'- GGATTTTGTTACATCTGCTGCAAAC -3'

Sequencing Primer
(F):5'- AGGGACCTTTTCAGATCAGC -3'
(R):5'- TCTGCTGCAAACCTCAGGATG -3'
Posted On2020-07-28