Incidental Mutation 'R7158:Nme2'
ID557457
Institutional Source Beutler Lab
Gene Symbol Nme2
Ensembl Gene ENSMUSG00000020857
Gene NameNME/NM23 nucleoside diphosphate kinase 2
SynonymsNM23-H2, non-metastatic cells 2, protein (NM23B) expressed in, nm23-M2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location93949814-93956259 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) G to A at 93955658 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000132590 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021217] [ENSMUST00000021220] [ENSMUST00000072566] [ENSMUST00000135884] [ENSMUST00000170303]
Predicted Effect probably benign
Transcript: ENSMUST00000021217
SMART Domains Protein: ENSMUSP00000021217
Gene: ENSMUSG00000020857

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021220
SMART Domains Protein: ENSMUSP00000021220
Gene: ENSMUSG00000037601

DomainStartEndE-ValueType
NDK 4 127 8.86e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000072566
SMART Domains Protein: ENSMUSP00000103476
Gene: ENSMUSG00000020857

DomainStartEndE-ValueType
NDK 4 141 2.8e-90 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135884
SMART Domains Protein: ENSMUSP00000117022
Gene: ENSMUSG00000037601

DomainStartEndE-ValueType
NDK 4 141 5.74e-87 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170303
SMART Domains Protein: ENSMUSP00000132590
Gene: ENSMUSG00000091228

DomainStartEndE-ValueType
NDK 4 118 7.56e-55 SMART
NDK 119 256 2.8e-90 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoside diphosphate kinase (NDK) exists as a hexamer composed of 'A' (encoded by NME1) and 'B' (encoded by this gene) isoforms. Multiple alternatively spliced transcript variants have been found for this gene. Read-through transcription from the neighboring upstream gene (NME1) generates naturally-occurring transcripts (NME1-NME2) that encode a fusion protein comprised of sequence sharing identity with each individual gene product. [provided by RefSeq, Nov 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired Th1 and Th2 cell KCa3.1 channel activity and TCR-stimulated calcium ion flux and cytokine production. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Ptch2 C T 4: 117,114,784 P1168S possibly damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Nme2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0040:Nme2 UTSW 11 93951930 unclassified probably null
R1297:Nme2 UTSW 11 93951956 missense possibly damaging 0.94
R3838:Nme2 UTSW 11 93949977 missense probably benign 0.00
R4612:Nme2 UTSW 11 93955602 missense possibly damaging 0.91
R7055:Nme2 UTSW 11 93955590 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TCGTGGGAGTGAAATCAGCC -3'
(R):5'- GGTAAGGCTAAGATGCACTCCC -3'

Sequencing Primer
(F):5'- CAAACTACTGGCGGGCGAAC -3'
(R):5'- TAAGATGCACTCCCCGCCC -3'
Posted On2019-06-26