Incidental Mutation 'R7158:Ptch2'
ID557424
Institutional Source Beutler Lab
Gene Symbol Ptch2
Ensembl Gene ENSMUSG00000028681
Gene Namepatched 2
Synonymsptc2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7158 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location117096075-117116101 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 117114784 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 1168 (P1168S)
Ref Sequence ENSEMBL: ENSMUSP00000030443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030443] [ENSMUST00000144620]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030443
AA Change: P1168S

PolyPhen 2 Score 0.764 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000030443
Gene: ENSMUSG00000028681
AA Change: P1168S

DomainStartEndE-ValueType
low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Pfam:Patched 338 831 1.6e-42 PFAM
Pfam:Sterol-sensing 418 570 9.5e-49 PFAM
Pfam:Patched 901 1116 2e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144620
SMART Domains Protein: ENSMUSP00000122548
Gene: ENSMUSG00000028681

DomainStartEndE-ValueType
low complexity region 58 77 N/A INTRINSIC
low complexity region 251 262 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency 100% (68/68)
MGI Phenotype FUNCTION: This gene encodes a member of the patched family of transmembrane receptor proteins. The encoded protein may be a functional receptor for the morphogen sonic hedgehog (Shh) and is reportedly involved in limb and skin development. Homozygous mutant mice for this gene exhibit hair loss and epidermal hyperplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2015]
PHENOTYPE: Male mice homozygous for a targeted gene disruption display anemia, abnormal red blood cells, enlarged spleens, extramedullary hematopoiesis, and an increased percentage of neutrophils. Most male mice homozygous for another allele display alopecia and skin lesions. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A T 11: 9,273,982 M454L probably benign Het
Abca8b T A 11: 109,934,589 E1595V probably damaging Het
Actr5 T A 2: 158,626,414 C155S possibly damaging Het
Acvr1b T A 15: 101,194,058 V73E probably benign Het
Add2 T C 6: 86,085,952 Y31H probably damaging Het
Akap13 G T 7: 75,579,594 V92F probably damaging Het
Alox8 T A 11: 69,185,870 M568L probably benign Het
Birc6 A T 17: 74,594,376 E1145V probably benign Het
Cacng1 A T 11: 107,703,839 M166K probably damaging Het
Ces1f A G 8: 93,268,016 F256L probably benign Het
Clpb A G 7: 101,663,832 R8G probably benign Het
Col6a5 A G 9: 105,864,208 V2504A possibly damaging Het
Coq8a T C 1: 180,179,184 D93G probably benign Het
Cry2 A T 2: 92,413,715 I371N probably damaging Het
Ddx43 A C 9: 78,412,219 Q276H probably damaging Het
Dock10 T C 1: 80,586,872 probably null Het
Dst A G 1: 34,274,285 T4378A probably benign Het
Fezf1 T C 6: 23,245,790 T459A probably benign Het
Gm10097 C T 10: 5,069,407 A72V unknown Het
Hydin A G 8: 110,609,671 S5027G possibly damaging Het
Inhbb A T 1: 119,421,022 L22* probably null Het
Kat8 G A 7: 127,922,159 G228S probably benign Het
Kif15 T A 9: 122,999,314 S897T probably benign Het
Kndc1 A G 7: 139,931,860 Y1460C possibly damaging Het
Krt78 T A 15: 101,951,806 D225V probably benign Het
Lama3 A T 18: 12,456,812 I800F probably benign Het
Mdn1 C A 4: 32,725,121 T2580K probably benign Het
Mest T C 6: 30,744,914 F201S possibly damaging Het
Mtmr9 A G 14: 63,526,869 F470L probably benign Het
Nfic C T 10: 81,420,605 R75Q probably damaging Het
Nme2 G A 11: 93,955,658 probably benign Het
Nrg4 A G 9: 55,242,100 L71P probably damaging Het
Pacsin2 C T 15: 83,379,742 E365K possibly damaging Het
Pappa T C 4: 65,204,867 I813T possibly damaging Het
Pcdhgb4 A G 18: 37,720,885 E111G probably damaging Het
Pdzd8 C T 19: 59,300,157 R937H probably damaging Het
Per1 T G 11: 69,104,104 probably benign Het
Pex2 A G 3: 5,561,336 F138L probably benign Het
Pold1 A T 7: 44,538,866 N529K probably damaging Het
Pou6f2 T C 13: 18,152,038 I316V Het
Prom1 A C 5: 44,012,913 I682S probably damaging Het
Prpf40a T C 2: 53,152,553 K481E probably damaging Het
Prrg4 A T 2: 104,832,613 V216E probably damaging Het
Pvr C A 7: 19,918,637 E118* probably null Het
R3hcc1l C T 19: 42,583,429 P716S probably damaging Het
Rasa4 A G 5: 136,102,021 E382G probably damaging Het
Rbp3 T A 14: 33,955,556 M487K probably benign Het
Rsad2 A T 12: 26,450,780 probably null Het
Shmt1 T C 11: 60,790,242 I353V probably benign Het
Shprh C T 10: 11,166,730 T819I probably damaging Het
Skap1 T A 11: 96,526,057 F56Y possibly damaging Het
Slc22a16 G T 10: 40,573,741 V79L possibly damaging Het
Slc34a1 A G 13: 55,401,231 T165A probably damaging Het
Smchd1 A C 17: 71,400,150 I941R probably damaging Het
Syne1 C A 10: 5,057,931 V98F probably damaging Het
Tcaim A G 9: 122,818,990 D190G possibly damaging Het
Tdrd9 G C 12: 112,036,366 E816D probably benign Het
Tmem132d T C 5: 128,137,019 K326E possibly damaging Het
Uhrf1bp1 T A 17: 27,886,433 C644* probably null Het
Usp35 T C 7: 97,325,964 M1V probably null Het
Wdr62 C T 7: 30,270,738 V215I possibly damaging Het
Zan T C 5: 137,400,644 T4153A unknown Het
Zfp239 G T 6: 117,871,729 E143* probably null Het
Zfp292 T C 4: 34,808,679 D1460G probably benign Het
Zfp647 C T 15: 76,917,305 G90R probably benign Het
Other mutations in Ptch2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01480:Ptch2 APN 4 117114082 missense probably damaging 1.00
IGL01684:Ptch2 APN 4 117104787 missense probably damaging 1.00
IGL01967:Ptch2 APN 4 117114233 splice site probably benign
IGL02449:Ptch2 APN 4 117108183 missense possibly damaging 0.79
IGL02488:Ptch2 APN 4 117110396 missense probably damaging 0.99
IGL02935:Ptch2 APN 4 117114770 missense probably damaging 1.00
R0103:Ptch2 UTSW 4 117109425 splice site probably benign
R0326:Ptch2 UTSW 4 117108884 missense probably damaging 1.00
R0403:Ptch2 UTSW 4 117110839 nonsense probably null
R0499:Ptch2 UTSW 4 117111143 nonsense probably null
R0550:Ptch2 UTSW 4 117096433 splice site probably benign
R0565:Ptch2 UTSW 4 117106143 splice site probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1469:Ptch2 UTSW 4 117108465 missense probably benign
R1484:Ptch2 UTSW 4 117110849 missense probably damaging 0.97
R1920:Ptch2 UTSW 4 117108661 missense probably benign 0.09
R4080:Ptch2 UTSW 4 117111206 missense probably damaging 1.00
R4611:Ptch2 UTSW 4 117110378 missense probably benign 0.24
R5117:Ptch2 UTSW 4 117105949 missense probably damaging 1.00
R5240:Ptch2 UTSW 4 117106138 splice site probably benign
R5936:Ptch2 UTSW 4 117108294 missense probably benign 0.39
R5987:Ptch2 UTSW 4 117110057 missense probably benign 0.13
R6155:Ptch2 UTSW 4 117096908 missense probably damaging 1.00
R7196:Ptch2 UTSW 4 117114749 missense probably benign 0.23
R7346:Ptch2 UTSW 4 117114652 missense probably benign 0.40
R7380:Ptch2 UTSW 4 117114646 missense possibly damaging 0.92
R7547:Ptch2 UTSW 4 117109964 missense probably damaging 1.00
R7600:Ptch2 UTSW 4 117096225 start gained probably benign
R7731:Ptch2 UTSW 4 117108295 missense probably benign 0.09
X0019:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0024:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0025:Ptch2 UTSW 4 117096986 missense probably damaging 1.00
X0035:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0038:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0039:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0040:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0052:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0053:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0054:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
X0061:Ptch2 UTSW 4 117109867 missense possibly damaging 0.64
Predicted Primers PCR Primer
(F):5'- TGTGAAATCTGACCGGGAGC -3'
(R):5'- TACAGACAGCAGCATAAGGC -3'

Sequencing Primer
(F):5'- AGCCTGGCTTGGGACTG -3'
(R):5'- AGCATAAGGCCCTCCAGG -3'
Posted On2019-06-26