Incidental Mutation 'R7189:Chrna7'
ID559493
Institutional Source Beutler Lab
Gene Symbol Chrna7
Ensembl Gene ENSMUSG00000030525
Gene Namecholinergic receptor, nicotinic, alpha polypeptide 7
Synonymsalpha7-nAChR, alpha7, Acra7, alpha7 nicotinic receptor
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7189 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location63098692-63212569 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63106027 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 257 (D257G)
Ref Sequence ENSEMBL: ENSMUSP00000032738 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032738]
Predicted Effect probably damaging
Transcript: ENSMUST00000032738
AA Change: D257G

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000032738
Gene: ENSMUSG00000030525
AA Change: D257G

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
Pfam:Neur_chan_LBD 26 230 1e-75 PFAM
Pfam:Neur_chan_memb 237 487 3.6e-63 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 95% (57/60)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The nicotinic acetylcholine receptors (nAChRs) are members of a superfamily of ligand-gated ion channels that mediate fast signal transmission at synapses. The nAChRs are thought to be hetero-pentamers composed of homologous subunits. The proposed structure for each subunit is a conserved N-terminal extracellular domain followed by three conserved transmembrane domains, a variable cytoplasmic loop, a fourth conserved transmembrane domain, and a short C-terminal extracellular region. The protein encoded by this gene forms a homo-oligomeric channel, displays marked permeability to calcium ions and is a major component of brain nicotinic receptors that are blocked by, and highly sensitive to, alpha-bungarotoxin. Once this receptor binds acetylcholine, it undergoes an extensive change in conformation that affects all subunits and leads to opening of an ion-conducting channel across the plasma membrane. This gene is located in a region identified as a major susceptibility locus for juvenile myoclonic epilepsy and a chromosomal location involved in the genetic transmission of schizophrenia. An evolutionarily recent partial duplication event in this region results in a hybrid containing sequence from this gene and a novel FAM7A gene. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012]
PHENOTYPE: Nullizygous mice lack hippocampal fast nicotinic currents but show nicotine-induced seizures as well as altered anxiety behavior, fertility defects, airway basal cell hyperplasia. and higher TNF sythesis when endotoxemic. Newborns homozygous for a knock-in allele die with increased neuron apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 G T 2: 103,567,516 A264S probably benign Het
Atr G T 9: 95,862,791 E54* probably null Het
Bmp4 A G 14: 46,383,999 S363P probably damaging Het
Cfap54 C A 10: 92,937,728 A2077S unknown Het
Chrnd C T 1: 87,191,058 R46W probably damaging Het
Cntn2 A G 1: 132,517,086 I851T probably damaging Het
Col3a1 T A 1: 45,333,657 I534K unknown Het
Cyp3a25 A T 5: 146,003,060 L46I probably benign Het
Dnah7b G C 1: 46,242,142 G2788R probably damaging Het
Dnpep T C 1: 75,313,430 E301G probably damaging Het
Efcab3 T C 11: 105,095,864 S30P probably benign Het
Elk4 A G 1: 132,019,389 I373V probably damaging Het
Fam161b T C 12: 84,348,646 S508G probably damaging Het
Fam198b T A 3: 79,886,807 L194* probably null Het
Fam214a T C 9: 75,004,351 C42R probably damaging Het
Fam71d C T 12: 78,712,208 P101S probably benign Het
Fgf10 A G 13: 118,789,123 E146G probably benign Het
Fsip2 A G 2: 82,993,237 D6438G possibly damaging Het
Gm3139 T A 5: 94,537,751 Y423* probably null Het
Gm49355 T A 14: 12,296,672 C10* probably null Het
Hfm1 A G 5: 106,901,703 probably null Het
Hivep3 T C 4: 120,132,219 S1956P probably damaging Het
Hrh2 A G 13: 54,221,251 S369G unknown Het
Hspg2 T C 4: 137,533,561 probably null Het
Hsph1 T C 5: 149,630,460 Y181C probably damaging Het
Kcnh8 A G 17: 52,894,117 probably null Het
Kctd1 C T 18: 15,062,643 E308K possibly damaging Het
Kdm8 A T 7: 125,460,931 Y335F probably damaging Het
Kif2b C G 11: 91,577,137 G107R probably benign Het
Lama4 G A 10: 38,965,733 probably benign Het
Lepr T C 4: 101,814,764 V995A probably benign Het
Mfsd4a A T 1: 132,052,393 V375E probably damaging Het
Mgl2 G T 11: 70,137,043 W359L probably damaging Het
Muc5b C A 7: 141,861,061 Y2581* probably null Het
Nol10 G T 12: 17,373,561 probably null Het
Olfr1297 T A 2: 111,621,193 M294L probably benign Het
Olfr665 A T 7: 104,881,141 K145* probably null Het
Otud3 C T 4: 138,909,554 V99M probably damaging Het
Parvb T C 15: 84,303,471 probably null Het
Pclo C A 5: 14,521,918 P439Q possibly damaging Het
Peg10 CATCAGGATCCCCATCAGGATGCACATCAGGATCCACATCAGGATGCACATCAGGATC CATC 6: 4,756,431 probably benign Het
Pkn1 A T 8: 83,692,673 H100Q possibly damaging Het
Plce1 A T 19: 38,760,137 I1771F probably damaging Het
Plxna2 G T 1: 194,801,058 R1559L possibly damaging Het
Ppp2r3a T A 9: 101,126,422 I416L possibly damaging Het
Robo1 C A 16: 72,960,151 C333* probably null Het
Ryr2 A T 13: 11,883,123 Y129N probably damaging Het
Schip1 A T 3: 68,617,699 K359M probably damaging Het
Schip1 G T 3: 68,617,700 K359N probably damaging Het
Sh2d2a T A 3: 87,848,361 S65T possibly damaging Het
Ssrp1 G A 2: 85,045,562 M588I probably benign Het
Stim2 T A 5: 54,116,128 C567S probably benign Het
Syne1 C A 10: 5,424,295 A171S probably benign Het
Tigd3 A G 19: 5,893,022 S27P probably benign Het
Vipr1 C A 9: 121,664,554 Q224K probably damaging Het
Vmn1r75 T A 7: 11,880,548 M69K possibly damaging Het
Vmn2r72 T G 7: 85,754,917 D22A probably benign Het
Zbtb24 G A 10: 41,464,476 V523I probably benign Het
Zbtb43 A G 2: 33,462,295 F20S probably benign Het
Other mutations in Chrna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01776:Chrna7 APN 7 63099519 missense probably benign 0.01
IGL01999:Chrna7 APN 7 63103791 missense probably damaging 1.00
IGL02016:Chrna7 APN 7 63103835 missense probably damaging 1.00
IGL02388:Chrna7 APN 7 63107691 missense probably damaging 1.00
IGL02400:Chrna7 APN 7 63099322 missense probably damaging 1.00
IGL02458:Chrna7 APN 7 63106094 missense probably damaging 1.00
IGL03039:Chrna7 APN 7 63148592 missense probably damaging 1.00
inflation UTSW 7 63148601 missense probably damaging 1.00
thaler UTSW 7 63106027 missense probably damaging 1.00
R0034:Chrna7 UTSW 7 63148606 missense possibly damaging 0.79
R0631:Chrna7 UTSW 7 63099643 missense probably benign 0.00
R1666:Chrna7 UTSW 7 63212142 missense possibly damaging 0.70
R1703:Chrna7 UTSW 7 63099507 missense probably damaging 0.99
R1763:Chrna7 UTSW 7 63099252 missense probably benign 0.05
R1974:Chrna7 UTSW 7 63099286 missense probably damaging 1.00
R2294:Chrna7 UTSW 7 63110424 missense probably benign 0.11
R2393:Chrna7 UTSW 7 63099246 missense probably damaging 1.00
R4598:Chrna7 UTSW 7 63103790 missense probably damaging 1.00
R4599:Chrna7 UTSW 7 63103790 missense probably damaging 1.00
R4842:Chrna7 UTSW 7 63212448 missense probably benign 0.05
R5143:Chrna7 UTSW 7 63106147 missense probably damaging 1.00
R5310:Chrna7 UTSW 7 63106057 missense probably damaging 1.00
R5339:Chrna7 UTSW 7 63099307 missense probably damaging 1.00
R5516:Chrna7 UTSW 7 63099298 missense probably damaging 0.98
R5807:Chrna7 UTSW 7 63148601 missense probably damaging 1.00
R6501:Chrna7 UTSW 7 63106115 missense probably damaging 1.00
R6918:Chrna7 UTSW 7 63159551 missense probably benign 0.03
R7000:Chrna7 UTSW 7 63106039 missense probably damaging 1.00
R7483:Chrna7 UTSW 7 63104990 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCACAAGACCGGGGAATCC -3'
(R):5'- TCCCTGGCAAAAGGAATGAG -3'

Sequencing Primer
(F):5'- TGTCTCCTTAAGAATCAGAACCAGGG -3'
(R):5'- GAATGAGAAGTTCTATGAATGCTGC -3'
Posted On2019-06-26