Incidental Mutation 'R7242:Hsd3b1'
ID563268
Institutional Source Beutler Lab
Gene Symbol Hsd3b1
Ensembl Gene ENSMUSG00000027871
Gene Namehydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1
SynonymsD3Ertd383e
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R7242 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location98852194-98859794 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 98853210 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 155 (Y155C)
Ref Sequence ENSEMBL: ENSMUSP00000102630 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029465] [ENSMUST00000107016]
Predicted Effect probably damaging
Transcript: ENSMUST00000029465
AA Change: Y155C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029465
Gene: ENSMUSG00000027871
AA Change: Y155C

DomainStartEndE-ValueType
Pfam:Epimerase 24 248 3.8e-23 PFAM
Pfam:NAD_binding_4 25 226 3.4e-18 PFAM
Pfam:Polysacc_synt_2 30 129 1.3e-8 PFAM
Pfam:3Beta_HSD 34 282 1.8e-102 PFAM
Pfam:NAD_binding_10 35 228 1.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000107016
AA Change: Y155C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102630
Gene: ENSMUSG00000027871
AA Change: Y155C

DomainStartEndE-ValueType
Pfam:RmlD_sub_bind 4 264 4.3e-8 PFAM
Pfam:KR 5 133 1.1e-7 PFAM
Pfam:Ldh_1_N 5 135 4.3e-7 PFAM
Pfam:Polysacc_synt_2 6 136 3e-14 PFAM
Pfam:NmrA 6 138 6.2e-10 PFAM
Pfam:Epimerase 6 250 2.9e-30 PFAM
Pfam:GDP_Man_Dehyd 7 216 6.6e-16 PFAM
Pfam:3Beta_HSD 7 288 2.1e-122 PFAM
Pfam:NAD_binding_4 8 219 4e-21 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that catalyzes the oxidative conversion of delta(5)-ene-3-beta-hydroxy steroid, and the oxidative conversion of ketosteroids. It plays a crucial role in the biosynthesis of all classes of hormonal steroids. This gene is predominantly expressed in the adrenals and the gonads. Mutations in this gene are associated with 3-beta-hydroxysteroid dehydrogenase, type II, deficiency. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 74 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1600015I10Rik A T 6: 48,931,128 Y354F probably damaging Het
1700001J03Rik A T 5: 146,184,867 I74N probably damaging Het
4921501E09Rik A G 17: 33,067,127 Y234H probably damaging Het
Abca6 A T 11: 110,241,653 V272D possibly damaging Het
Acot11 A T 4: 106,762,493 S163R probably benign Het
Adcy5 T C 16: 35,156,835 L246P probably damaging Het
Adgra1 A T 7: 139,847,657 probably null Het
Adgra2 A G 8: 27,122,027 T1335A probably damaging Het
Armt1 T C 10: 4,453,475 S187P probably damaging Het
Azin1 T C 15: 38,501,505 M1V probably null Het
B430305J03Rik C T 3: 61,363,835 C163Y unknown Het
Cables1 T C 18: 11,840,007 S68P possibly damaging Het
Cacna1d A G 14: 30,178,706 F341L probably benign Het
Ccdc90b T A 7: 92,572,568 H118Q probably damaging Het
Celf1 T A 2: 91,003,257 C119* probably null Het
Cfap57 C T 4: 118,593,096 V610M possibly damaging Het
Chrm4 T A 2: 91,927,250 M1K probably null Het
Chrnd C T 1: 87,197,479 T418I probably damaging Het
Coch G T 12: 51,593,561 probably benign Het
Cop1 A G 1: 159,284,548 T345A probably benign Het
Cops6 A G 5: 138,163,580 T96A probably benign Het
Corin T C 5: 72,305,055 I945V probably benign Het
Cyp2c67 G T 19: 39,617,339 T371N probably benign Het
Dap T A 15: 31,273,308 *103R probably null Het
Defb35 T A 8: 21,940,757 V49E unknown Het
Dmtf1 T A 5: 9,149,016 D39V possibly damaging Het
Dmtn T C 14: 70,618,020 T10A probably damaging Het
Dnajc1 C T 2: 18,293,972 E264K probably benign Het
Dtx3l A T 16: 35,933,401 N278K possibly damaging Het
Fam161a T A 11: 23,020,037 S72T possibly damaging Het
Fnbp4 T A 2: 90,745,796 S114T unknown Het
Focad T G 4: 88,309,906 I784S unknown Het
Fzd8 A T 18: 9,214,171 T418S probably damaging Het
Gclc A G 9: 77,785,371 Y264C probably benign Het
Ggn G A 7: 29,173,034 C649Y possibly damaging Het
Gm10184 G A 17: 89,910,135 T61I probably benign Het
Gys1 A G 7: 45,439,668 probably null Het
Htatip2 A G 7: 49,772,606 K191E probably benign Het
Ik A T 18: 36,748,222 S79C probably null Het
Kin G A 2: 10,091,793 R151Q probably benign Het
Mast4 A G 13: 102,738,478 S1461P probably damaging Het
Melk T A 4: 44,360,885 V555E probably damaging Het
Met G A 6: 17,491,317 C26Y probably damaging Het
Mfsd6 A T 1: 52,709,474 F77L probably damaging Het
Mib1 T A 18: 10,741,011 D86E probably damaging Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Olfr1120 G A 2: 87,358,082 V213I probably benign Het
Olfr1352 A T 10: 78,984,497 K236* probably null Het
Olfr504 T G 7: 108,565,712 S28R probably benign Het
Olfr935 A G 9: 38,995,141 I98T probably benign Het
Patj A T 4: 98,591,933 I1296L probably benign Het
Pcdh1 C T 18: 38,203,217 V122M probably benign Het
Pcdhac2 A T 18: 37,144,893 I309F possibly damaging Het
Phtf1 A G 3: 103,998,696 S565G probably damaging Het
Plekha2 A C 8: 25,088,395 F30V probably damaging Het
Ptbp1 A G 10: 79,856,388 M20V unknown Het
Pth2r A G 1: 65,388,620 D484G probably benign Het
Rapgef2 G A 3: 79,087,903 Q665* probably null Het
Scamp1 G A 13: 94,233,140 T59I probably benign Het
Sema4a T A 3: 88,450,109 D230V probably damaging Het
Snw1 C T 12: 87,468,645 G45R possibly damaging Het
Sox30 T A 11: 45,984,520 probably null Het
Sspo T A 6: 48,473,952 I2665K probably benign Het
Stx5a T A 19: 8,755,277 W437R unknown Het
Tln1 A G 4: 43,542,602 V1402A probably benign Het
Tpm1 A G 9: 67,028,101 L244P probably benign Het
Try5 T A 6: 41,313,454 E32V probably benign Het
Ttn T C 2: 76,721,729 N31188S probably benign Het
Tulp1 T C 17: 28,363,405 probably null Het
Usp13 T G 3: 32,865,743 probably null Het
Vax2 A G 6: 83,711,316 E7G possibly damaging Het
Vmn2r45 A T 7: 8,485,613 Y139* probably null Het
Wisp2 T C 2: 163,828,852 F93S probably benign Het
Zfp423 T C 8: 87,904,527 D21G probably benign Het
Other mutations in Hsd3b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00534:Hsd3b1 APN 3 98853246 missense probably damaging 1.00
IGL01955:Hsd3b1 APN 3 98853147 missense probably benign 0.08
IGL02894:Hsd3b1 APN 3 98852929 missense possibly damaging 0.88
IGL03136:Hsd3b1 APN 3 98852985 missense probably damaging 1.00
R0265:Hsd3b1 UTSW 3 98852773 missense probably damaging 1.00
R0326:Hsd3b1 UTSW 3 98853274 missense probably damaging 1.00
R0390:Hsd3b1 UTSW 3 98853039 missense probably damaging 1.00
R1532:Hsd3b1 UTSW 3 98852898 missense probably damaging 1.00
R2845:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2846:Hsd3b1 UTSW 3 98852778 missense probably damaging 1.00
R2898:Hsd3b1 UTSW 3 98853307 missense probably benign 0.00
R3153:Hsd3b1 UTSW 3 98852664 missense probably damaging 0.99
R3950:Hsd3b1 UTSW 3 98856138 missense possibly damaging 0.79
R4456:Hsd3b1 UTSW 3 98856143 missense probably benign 0.01
R4792:Hsd3b1 UTSW 3 98852910 missense probably benign 0.22
R4799:Hsd3b1 UTSW 3 98852865 missense probably benign 0.07
R4898:Hsd3b1 UTSW 3 98853326 missense probably benign 0.12
R5512:Hsd3b1 UTSW 3 98853205 missense probably benign 0.06
R5834:Hsd3b1 UTSW 3 98852939 missense possibly damaging 0.60
R5921:Hsd3b1 UTSW 3 98857899 missense probably benign 0.06
R6221:Hsd3b1 UTSW 3 98853156 missense probably benign 0.00
R6918:Hsd3b1 UTSW 3 98853109 missense probably damaging 0.98
R7058:Hsd3b1 UTSW 3 98857815 splice site probably null
R8181:Hsd3b1 UTSW 3 98856137 missense probably damaging 1.00
R8187:Hsd3b1 UTSW 3 98852617 missense probably damaging 1.00
R8237:Hsd3b1 UTSW 3 98853110 missense possibly damaging 0.65
Z1176:Hsd3b1 UTSW 3 98852886 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CACATATACTGGGTTGGCTATGG -3'
(R):5'- TTTTCCAACACTGACACTGACAG -3'

Sequencing Primer
(F):5'- GCTATGGAGAATTTGCCAGTAACAC -3'
(R):5'- ACAGTGTGTTGTCTGTGATTAGGTAC -3'
Posted On2019-06-26