Incidental Mutation 'R7273:Il1r2'
ID565383
Institutional Source Beutler Lab
Gene Symbol Il1r2
Ensembl Gene ENSMUSG00000026073
Gene Nameinterleukin 1 receptor, type II
SynonymsIL-1 receptor beta chain, CD121b, Il1r-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7273 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location40074079-40125231 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 40112007 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 141 (T141A)
Ref Sequence ENSEMBL: ENSMUSP00000027243 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027243] [ENSMUST00000191671] [ENSMUST00000195770]
Predicted Effect probably benign
Transcript: ENSMUST00000027243
AA Change: T141A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000027243
Gene: ENSMUSG00000026073
AA Change: T141A

DomainStartEndE-ValueType
IG 49 138 2.48e-8 SMART
IG 149 241 1.6e-2 SMART
IG 255 354 1.32e-3 SMART
transmembrane domain 359 381 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191671
AA Change: T141A

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000141882
Gene: ENSMUSG00000026073
AA Change: T141A

DomainStartEndE-ValueType
IG 49 138 1e-10 SMART
Blast:IG 149 183 2e-16 BLAST
Predicted Effect unknown
Transcript: ENSMUST00000195770
AA Change: I54M
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (49/49)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytokine receptor that belongs to the interleukin 1 receptor family. This protein binds interleukin alpha (IL1A), interleukin beta (IL1B), and interleukin 1 receptor, type I(IL1R1/IL1RA), and acts as a decoy receptor that inhibits the activity of its ligands. Interleukin 4 (IL4) is reported to antagonize the activity of interleukin 1 by inducing the expression and release of this cytokine. This gene and three other genes form a cytokine receptor gene cluster on chromosome 2q12. Alternative splicing results in multiple transcript variants and protein isoforms. Alternative splicing produces both membrane-bound and soluble proteins. A soluble protein is also produced by proteolytic cleavage. [provided by RefSeq, May 2012]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apol10a A T 15: 77,488,868 I235F probably damaging Het
Aspn A T 13: 49,558,876 E222D probably benign Het
Cfap221 A T 1: 119,954,218 V280D possibly damaging Het
Chrd G A 16: 20,741,566 R922Q probably benign Het
Cnga4 T A 7: 105,406,965 V361E probably damaging Het
Col15a1 T A 4: 47,284,467 probably null Het
Col6a4 A G 9: 106,000,457 V2107A possibly damaging Het
Eea1 G T 10: 95,989,631 V63F probably benign Het
Eml1 A G 12: 108,538,173 H797R possibly damaging Het
Gm4858 G T 3: 93,074,168 M90I probably damaging Het
Gm4869 T A 5: 140,476,012 V523E probably damaging Het
Il6st T C 13: 112,495,298 V457A probably benign Het
Lrrc56 T C 7: 141,209,665 C532R probably benign Het
Lrrn4 T C 2: 132,879,829 S23G unknown Het
Mapk8ip3 A T 17: 24,906,174 D498E probably benign Het
Mcam T C 9: 44,140,944 F584S possibly damaging Het
Mdga1 A T 17: 29,969,938 D50E unknown Het
Mfsd7a T C 5: 108,441,991 D515G probably benign Het
Mga T C 2: 119,935,214 S1320P probably damaging Het
Muc5b G A 7: 141,851,570 G905D unknown Het
Ncor2 T C 5: 125,023,623 N1297S Het
Nisch A G 14: 31,174,407 V946A unknown Het
Npc1l1 A G 11: 6,218,320 F957S probably damaging Het
Nuggc A G 14: 65,619,608 N402S probably damaging Het
Nup210l A G 3: 90,118,547 T159A probably benign Het
Olfr981 A T 9: 40,022,665 I91F probably benign Het
Otud1 A G 2: 19,659,062 D334G probably damaging Het
Pclo T C 5: 14,681,594 V3370A unknown Het
Prdm16 A G 4: 154,345,453 L353P probably damaging Het
Prepl A C 17: 85,081,992 V128G probably benign Het
Pum1 T C 4: 130,751,480 V568A probably damaging Het
Rab10 G T 12: 3,256,891 S101R probably benign Het
Rfx3 C T 19: 27,802,458 R435Q probably damaging Het
Rnf213 A T 11: 119,431,756 probably null Het
Sema5a A G 15: 32,417,462 D26G probably benign Het
Smim4 G T 14: 31,124,598 R55S probably damaging Het
Spata31d1b G A 13: 59,717,632 V865I probably benign Het
Sycp3 A T 10: 88,469,566 Q176H probably damaging Het
Tmprss11d A T 5: 86,337,239 V102D probably damaging Het
Top1mt A G 15: 75,664,082 V457A probably benign Het
Tubal3 T A 13: 3,930,675 I129N probably damaging Het
Ubr3 G A 2: 69,979,333 D1217N probably damaging Het
Uggt1 A G 1: 36,162,221 I1146T probably damaging Het
Umod T C 7: 119,477,027 Q172R probably benign Het
Zdbf2 C T 1: 63,303,404 A314V possibly damaging Het
Zfp787 A T 7: 6,133,040 C71S possibly damaging Het
Zhx2 C T 15: 57,823,428 A731V probably benign Het
Other mutations in Il1r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01945:Il1r2 APN 1 40102453 missense possibly damaging 0.66
IGL02673:Il1r2 APN 1 40115163 missense probably damaging 1.00
R0019:Il1r2 UTSW 1 40125050 missense probably damaging 1.00
R0019:Il1r2 UTSW 1 40125050 missense probably damaging 1.00
R0299:Il1r2 UTSW 1 40123149 nonsense probably null
R0499:Il1r2 UTSW 1 40123149 nonsense probably null
R0607:Il1r2 UTSW 1 40105455 missense probably benign 0.06
R1435:Il1r2 UTSW 1 40105299 missense probably damaging 0.99
R1925:Il1r2 UTSW 1 40115148 missense probably damaging 0.99
R2209:Il1r2 UTSW 1 40115138 missense probably benign 0.02
R2240:Il1r2 UTSW 1 40105470 missense probably damaging 1.00
R4997:Il1r2 UTSW 1 40121046 critical splice donor site probably null
R7331:Il1r2 UTSW 1 40123249 missense probably benign 0.11
R7401:Il1r2 UTSW 1 40123210 missense probably damaging 1.00
R7751:Il1r2 UTSW 1 40123211 missense probably damaging 1.00
R7841:Il1r2 UTSW 1 40105468 missense probably damaging 1.00
R7924:Il1r2 UTSW 1 40105468 missense probably damaging 1.00
X0010:Il1r2 UTSW 1 40117981 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- GTAAGCCGCACTCTTCAAGG -3'
(R):5'- GAAATCATTTCACACTCTGCCTGC -3'

Sequencing Primer
(F):5'- TCTTCAAGGCAGGGCAGACTG -3'
(R):5'- ACACTCTGCCTGCATGAC -3'
Posted On2019-06-26