Incidental Mutation 'R7379:Ift57'
ID572594
Institutional Source Beutler Lab
Gene Symbol Ift57
Ensembl Gene ENSMUSG00000032965
Gene Nameintraflagellar transport 57
Synonyms4833420A15Rik, MHS4R2, HIPPI, Esrrbl1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7379 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location49699233-49765126 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49760994 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 341 (E341G)
Ref Sequence ENSEMBL: ENSMUSP00000046645 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046777] [ENSMUST00000142682]
Predicted Effect probably damaging
Transcript: ENSMUST00000046777
AA Change: E341G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000046645
Gene: ENSMUSG00000032965
AA Change: E341G

DomainStartEndE-ValueType
low complexity region 16 37 N/A INTRINSIC
Pfam:IFT57 44 401 2.1e-154 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000116412
Gene: ENSMUSG00000032965
AA Change: E212G

DomainStartEndE-ValueType
transmembrane domain 13 35 N/A INTRINSIC
Pfam:IFT57 48 273 6.4e-84 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000142682
AA Change: E256G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117882
Gene: ENSMUSG00000032965
AA Change: E256G

DomainStartEndE-ValueType
Pfam:IFT57 1 272 5.5e-111 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation display embryonic lethality during organogenesis, abnormal left-right axis patterning, absence of embryonic cilia. random and delayed embryo turning, and abnormal neural tube development and morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ankrd12 G A 17: 65,985,247 R1064* probably null Het
Ccdc149 A G 5: 52,405,066 I206T probably damaging Het
Ctu1 AGGACCGGGCAGGAGCCACCTGTGTATCGCAGAGGGACCTGAGCCTTGGGAATGGAGGGGACCGGGCAGGAGCCACCTGTGTATCGCAG AGGACCGGGCAGGAGCCACCTGTGTATCGCAG 7: 43,677,066 probably benign Het
Cyp2j6 T C 4: 96,525,946 T361A probably damaging Het
Cyp4a14 A T 4: 115,493,710 probably null Het
Cyp7b1 A G 3: 18,097,374 V225A probably benign Het
Esf1 A G 2: 140,154,934 I503T probably benign Het
Flrt2 G A 12: 95,780,555 V556I possibly damaging Het
Gaa T C 11: 119,283,699 S791P probably benign Het
H2-T22 A G 17: 36,042,340 probably null Het
Hexb A G 13: 97,181,164 S342P probably damaging Het
Ift122 C T 6: 115,926,302 R1176C probably benign Het
Itpkc A T 7: 27,227,769 I240K probably benign Het
Kit A T 5: 75,647,752 S719C probably damaging Het
Klf1 T A 8: 84,903,217 Y224N possibly damaging Het
Krt77 T C 15: 101,861,274 E387G probably damaging Het
L3mbtl1 T A 2: 162,960,979 D347E probably damaging Het
Map1s A G 8: 70,913,575 T375A possibly damaging Het
Mturn A G 6: 54,689,084 T81A possibly damaging Het
Mug2 A G 6: 122,047,487 E506G possibly damaging Het
Notch1 A G 2: 26,479,467 F512S probably damaging Het
Olfr1148 T A 2: 87,833,779 C247S probably damaging Het
Olfr1255 T A 2: 89,816,689 V115E probably benign Het
Olfr1410 G T 1: 92,608,467 C210F possibly damaging Het
Olfr1510 T C 14: 52,410,261 T204A probably benign Het
Pcdhga10 A G 18: 37,747,566 N127D probably damaging Het
Plb1 A G 5: 32,345,639 I1148V probably damaging Het
Plcb1 A G 2: 135,370,510 D1007G probably benign Het
Prdm16 T A 4: 154,528,859 E37V probably damaging Het
Prss45 C A 9: 110,839,193 N151K possibly damaging Het
Rngtt A T 4: 33,498,981 K513* probably null Het
Serpinb10 T C 1: 107,532,387 probably benign Het
Shc1 T C 3: 89,426,822 V402A probably benign Het
Slc25a38 T A 9: 120,120,836 L227Q probably benign Het
Slc6a13 A T 6: 121,336,839 K514* probably null Het
Sorcs3 T C 19: 48,772,266 V911A possibly damaging Het
Sptb A T 12: 76,610,877 I1290N probably damaging Het
Sptbn1 T C 11: 30,139,292 K657E possibly damaging Het
Stpg4 T A 17: 87,427,640 probably null Het
Stx2 A G 5: 128,987,799 V278A possibly damaging Het
Thoc1 A T 18: 9,992,902 N558I probably benign Het
Trpm2 T C 10: 77,914,734 T1343A probably benign Het
Usf3 T A 16: 44,220,576 D1806E probably benign Het
Vmn2r106 C T 17: 20,267,775 M787I possibly damaging Het
Wdfy4 A G 14: 33,151,609 S248P Het
Zeb2 G T 2: 45,001,817 probably null Het
Other mutations in Ift57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02476:Ift57 APN 16 49763889 missense probably benign 0.39
R0636:Ift57 UTSW 16 49711896 missense probably benign 0.27
R1552:Ift57 UTSW 16 49759353 missense probably benign 0.09
R2172:Ift57 UTSW 16 49759340 missense probably benign 0.03
R2885:Ift57 UTSW 16 49763751 missense probably damaging 0.98
R4657:Ift57 UTSW 16 49762594 splice site probably null
R4761:Ift57 UTSW 16 49701900 missense probably damaging 1.00
R5726:Ift57 UTSW 16 49699498 missense probably damaging 1.00
R5958:Ift57 UTSW 16 49711108 intron probably benign
R6013:Ift57 UTSW 16 49699304 utr 5 prime probably null
R6189:Ift57 UTSW 16 49763813 missense probably damaging 1.00
R6390:Ift57 UTSW 16 49762473 intron probably null
R6749:Ift57 UTSW 16 49760984 missense probably benign 0.23
R6862:Ift57 UTSW 16 49763804 missense possibly damaging 0.49
R7073:Ift57 UTSW 16 49763867 missense probably benign 0.10
R7556:Ift57 UTSW 16 49706128 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCACTTAAATGCATGGCGCC -3'
(R):5'- CCAAGAGAAGGATTATTGGTTCAC -3'

Sequencing Primer
(F):5'- TGCATGGCGCCTATTAATAAGGAC -3'
(R):5'- GGTTCACATGTTAGCGAACTTC -3'
Posted On2019-09-13