Incidental Mutation 'R7444:Sh3rf2'
ID577197
Institutional Source Beutler Lab
Gene Symbol Sh3rf2
Ensembl Gene ENSMUSG00000057719
Gene NameSH3 domain containing ring finger 2
Synonyms9130023G24Rik, RNF158
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7444 (G1)
Quality Score225.009
Status Not validated
Chromosome18
Chromosomal Location42053667-42158960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 42101539 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 129 (R129Q)
Ref Sequence ENSEMBL: ENSMUSP00000071896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072008] [ENSMUST00000074679]
PDB Structure Solution structure of the SH3 domain of the mouse hypothetical protein SH3RF2 [SOLUTION NMR]
The solution structure of the first SH3 domain of mouse SH3 domain containing ring finger 2 [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000072008
AA Change: R129Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071896
Gene: ENSMUSG00000057719
AA Change: R129Q

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
SH3 190 251 1.45e-13 SMART
low complexity region 357 366 N/A INTRINSIC
SH3 385 442 3.27e-12 SMART
low complexity region 500 514 N/A INTRINSIC
low complexity region 614 631 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000074679
AA Change: R129Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000074247
Gene: ENSMUSG00000057719
AA Change: R129Q

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
low complexity region 325 334 N/A INTRINSIC
SH3 353 410 3.27e-12 SMART
low complexity region 468 482 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,007,423 M2024V probably benign Het
Ahnak2 T A 12: 112,781,208 Q1673L Het
Atic G T 1: 71,563,787 V107L probably benign Het
B2m A G 2: 122,150,935 N44D probably damaging Het
Bud13 A G 9: 46,298,501 D636G probably damaging Het
Cenpk T C 13: 104,249,517 *307Q probably null Het
Cep68 A G 11: 20,239,438 S525P probably benign Het
Clca1 A G 3: 145,027,432 L105P probably damaging Het
Cntnap5a A T 1: 116,292,349 M630L probably benign Het
Cpb2 A G 14: 75,283,342 Y399C probably damaging Het
Dars2 G T 1: 161,046,884 P412T possibly damaging Het
E2f8 A T 7: 48,868,179 I665N probably damaging Het
Epha4 A T 1: 77,387,916 I652N probably damaging Het
Ermn ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 2: 58,048,067 probably benign Het
Flrt3 T C 2: 140,660,467 T414A probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fosb T C 7: 19,307,274 D98G possibly damaging Het
Gm5773 T C 3: 93,773,543 L174S probably damaging Het
Hectd3 T A 4: 116,996,927 V258E possibly damaging Het
Inf2 T A 12: 112,605,387 W617R unknown Het
Irf7 T A 7: 141,263,686 I358F probably damaging Het
Lipo3 A G 19: 33,558,263 probably null Het
Lrig2 A T 3: 104,497,513 L93* probably null Het
Lzts1 C T 8: 69,135,679 V542M probably damaging Het
Mefv T A 16: 3,715,522 H295L probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nat8f6 G C 6: 85,809,130 S12R probably benign Het
Nipal4 G T 11: 46,166,235 N14K probably benign Het
Nlrp4c T A 7: 6,092,596 C824* probably null Het
Npat T C 9: 53,548,910 S53P probably damaging Het
Nrxn3 A G 12: 89,510,694 E549G probably damaging Het
Olfr1120 T A 2: 87,358,100 L219I possibly damaging Het
Olfr1253 T C 2: 89,752,759 K23R probably benign Het
Olfr1318 A T 2: 112,156,715 I255F probably damaging Het
Olfr1347 C A 7: 6,487,920 W311L probably benign Het
Olfr398 T C 11: 73,983,750 N286S probably damaging Het
Olfr476 T A 7: 107,967,604 V69E probably damaging Het
Olfr713 T C 7: 107,036,347 L64P probably damaging Het
Olfr779 T C 10: 129,311,690 M61T probably benign Het
Pcdhb11 T A 18: 37,422,619 I334K probably damaging Het
Pcdhb4 T C 18: 37,309,452 L605P probably damaging Het
Pced1a G T 2: 130,422,059 H224Q probably damaging Het
Pde6b C A 5: 108,427,142 S623* probably null Het
Pgr T C 9: 8,946,882 L708P probably damaging Het
Pnpla1 T C 17: 28,878,481 I207T possibly damaging Het
Prkag3 A T 1: 74,747,266 D173E probably benign Het
Prrt4 A G 6: 29,176,517 F270L probably benign Het
Ptdss2 C A 7: 141,153,084 P260Q possibly damaging Het
Rftn1 T A 17: 50,047,407 N309I probably damaging Het
Rgs12 T C 5: 35,025,943 V978A possibly damaging Het
Rnf111 T C 9: 70,440,843 Y816C probably damaging Het
Rnf208 C T 2: 25,243,314 P7S probably damaging Het
Rnf24 T C 2: 131,313,295 D4G probably damaging Het
Ryr2 T A 13: 11,555,463 I4925L probably benign Het
S1pr5 A T 9: 21,245,082 V16D possibly damaging Het
Scgb1b24 A G 7: 33,744,141 D75G possibly damaging Het
Setdb2 A T 14: 59,423,345 C116* probably null Het
Spata31d1d C T 13: 59,727,193 V843I probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Tecrl T A 5: 83,355,068 probably benign Het
Tex15 T A 8: 33,576,562 S2007T possibly damaging Het
Tomm7 C A 5: 23,844,157 probably benign Het
Trpv1 A C 11: 73,244,204 N409T possibly damaging Het
Try5 T A 6: 41,311,365 Y218F probably benign Het
Tspan5 A T 3: 138,898,122 I196F possibly damaging Het
Wdhd1 A T 14: 47,251,948 C709* probably null Het
Other mutations in Sh3rf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Sh3rf2 APN 18 42111218 missense probably benign 0.00
IGL01012:Sh3rf2 APN 18 42054192 missense possibly damaging 0.50
IGL01286:Sh3rf2 APN 18 42139611 critical splice donor site probably null
IGL02369:Sh3rf2 APN 18 42156157 nonsense probably null
IGL02563:Sh3rf2 APN 18 42156142 missense probably damaging 0.99
BB004:Sh3rf2 UTSW 18 42111422 missense probably benign
BB014:Sh3rf2 UTSW 18 42111422 missense probably benign
PIT4445001:Sh3rf2 UTSW 18 42153164 missense probably benign 0.00
R0141:Sh3rf2 UTSW 18 42156057 missense probably benign 0.02
R0270:Sh3rf2 UTSW 18 42104081 missense probably damaging 0.99
R1447:Sh3rf2 UTSW 18 42101671 missense probably benign 0.00
R1491:Sh3rf2 UTSW 18 42053939 missense probably damaging 0.99
R1539:Sh3rf2 UTSW 18 42149822 missense probably damaging 1.00
R1595:Sh3rf2 UTSW 18 42111288 missense probably damaging 1.00
R1749:Sh3rf2 UTSW 18 42153294 missense probably damaging 1.00
R1864:Sh3rf2 UTSW 18 42053981 missense probably damaging 0.99
R1942:Sh3rf2 UTSW 18 42149624 missense probably damaging 1.00
R1998:Sh3rf2 UTSW 18 42141083 missense probably damaging 0.99
R2331:Sh3rf2 UTSW 18 42053863 missense probably benign 0.04
R2680:Sh3rf2 UTSW 18 42101650 missense probably damaging 0.98
R2938:Sh3rf2 UTSW 18 42149724 missense probably benign 0.09
R2940:Sh3rf2 UTSW 18 42111440 critical splice donor site probably null
R3753:Sh3rf2 UTSW 18 42111308 missense probably damaging 1.00
R3861:Sh3rf2 UTSW 18 42153319 missense probably damaging 1.00
R4322:Sh3rf2 UTSW 18 42111399 missense probably damaging 1.00
R5076:Sh3rf2 UTSW 18 42053924 missense probably damaging 1.00
R5169:Sh3rf2 UTSW 18 42153061 missense probably benign 0.00
R5228:Sh3rf2 UTSW 18 42153181 missense possibly damaging 0.69
R5437:Sh3rf2 UTSW 18 42141014 missense probably benign 0.44
R5792:Sh3rf2 UTSW 18 42111138 missense probably damaging 0.99
R5820:Sh3rf2 UTSW 18 42141047 missense possibly damaging 0.94
R6159:Sh3rf2 UTSW 18 42156135 missense probably damaging 0.96
R6366:Sh3rf2 UTSW 18 42153065 missense probably benign 0.00
R6640:Sh3rf2 UTSW 18 42101640 missense probably damaging 1.00
R6897:Sh3rf2 UTSW 18 42101605 missense possibly damaging 0.91
R6995:Sh3rf2 UTSW 18 42101541 missense probably damaging 1.00
R7097:Sh3rf2 UTSW 18 42104162 splice site probably null
R7122:Sh3rf2 UTSW 18 42104162 splice site probably null
R7432:Sh3rf2 UTSW 18 42054026 missense probably damaging 0.99
R7654:Sh3rf2 UTSW 18 42104108 missense probably damaging 1.00
R7703:Sh3rf2 UTSW 18 42156136 missense probably benign 0.04
R7732:Sh3rf2 UTSW 18 42101688 missense probably damaging 1.00
R7835:Sh3rf2 UTSW 18 42111170 missense probably benign 0.25
R7927:Sh3rf2 UTSW 18 42111422 missense probably benign
R8053:Sh3rf2 UTSW 18 42153022 missense probably damaging 1.00
R8144:Sh3rf2 UTSW 18 42141059 missense probably benign 0.01
R8343:Sh3rf2 UTSW 18 42111428 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGGAACAATCAACTATAGCCA -3'
(R):5'- GCAGCTGTTTGATGACTTCCA -3'

Sequencing Primer
(F):5'- CAACAGTTGGTTATCCAGTGCCAG -3'
(R):5'- TGATGACTTCCACAGAGCTG -3'
Posted On2019-10-07