Incidental Mutation 'R7444:Hectd3'
ID 577153
Institutional Source Beutler Lab
Gene Symbol Hectd3
Ensembl Gene ENSMUSG00000046861
Gene Name HECT domain E3 ubiquitin protein ligase 3
Synonyms 1700064K09Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7444 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 116995317-117005277 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 116996927 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 258 (V258E)
Ref Sequence ENSEMBL: ENSMUSP00000051922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030446] [ENSMUST00000050067] [ENSMUST00000130273]
AlphaFold Q3U487
Predicted Effect probably benign
Transcript: ENSMUST00000030446
SMART Domains Protein: ENSMUSP00000030446
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 14 360 2.4e-135 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000050067
AA Change: V258E

PolyPhen 2 Score 0.481 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000051922
Gene: ENSMUSG00000046861
AA Change: V258E

DomainStartEndE-ValueType
low complexity region 26 41 N/A INTRINSIC
low complexity region 68 81 N/A INTRINSIC
APC10 237 391 6.75e-23 SMART
HECTc 514 857 1.27e-30 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130273
SMART Domains Protein: ENSMUSP00000116154
Gene: ENSMUSG00000028684

DomainStartEndE-ValueType
Pfam:URO-D 1 64 1.2e-18 PFAM
Pfam:URO-D 60 120 4e-12 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene transfers ubiquitin from an E2 ubiquitin-conjugating enzyme to targeted substrates, leading to the degradation of those substrates. The encoded protein has been shown to transfer ubiquitin to TRIOBP to facilitate cell cycle progression, and to STX8. [provided by RefSeq, Dec 2012]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahnak A G 19: 9,007,423 M2024V probably benign Het
Ahnak2 T A 12: 112,781,208 Q1673L Het
Atic G T 1: 71,563,787 V107L probably benign Het
B2m A G 2: 122,150,935 N44D probably damaging Het
Bud13 A G 9: 46,298,501 D636G probably damaging Het
Cenpk T C 13: 104,249,517 *307Q probably null Het
Cep68 A G 11: 20,239,438 S525P probably benign Het
Clca1 A G 3: 145,027,432 L105P probably damaging Het
Cntnap5a A T 1: 116,292,349 M630L probably benign Het
Cpb2 A G 14: 75,283,342 Y399C probably damaging Het
Dars2 G T 1: 161,046,884 P412T possibly damaging Het
E2f8 A T 7: 48,868,179 I665N probably damaging Het
Epha4 A T 1: 77,387,916 I652N probably damaging Het
Ermn ACTTCTTCTTCTTCTTCTTCTTC ACTTCTTCTTCTTCTTCTTC 2: 58,048,067 probably benign Het
Flrt3 T C 2: 140,660,467 T414A probably benign Het
Fmn1 A T 2: 113,441,611 Q108L unknown Het
Fosb T C 7: 19,307,274 D98G possibly damaging Het
Gm5773 T C 3: 93,773,543 L174S probably damaging Het
Inf2 T A 12: 112,605,387 W617R unknown Het
Irf7 T A 7: 141,263,686 I358F probably damaging Het
Lipo3 A G 19: 33,558,263 probably null Het
Lrig2 A T 3: 104,497,513 L93* probably null Het
Lzts1 C T 8: 69,135,679 V542M probably damaging Het
Mefv T A 16: 3,715,522 H295L probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Nat8f6 G C 6: 85,809,130 S12R probably benign Het
Nipal4 G T 11: 46,166,235 N14K probably benign Het
Nlrp4c T A 7: 6,092,596 C824* probably null Het
Npat T C 9: 53,548,910 S53P probably damaging Het
Nrxn3 A G 12: 89,510,694 E549G probably damaging Het
Olfr1120 T A 2: 87,358,100 L219I possibly damaging Het
Olfr1253 T C 2: 89,752,759 K23R probably benign Het
Olfr1318 A T 2: 112,156,715 I255F probably damaging Het
Olfr1347 C A 7: 6,487,920 W311L probably benign Het
Olfr398 T C 11: 73,983,750 N286S probably damaging Het
Olfr476 T A 7: 107,967,604 V69E probably damaging Het
Olfr713 T C 7: 107,036,347 L64P probably damaging Het
Olfr779 T C 10: 129,311,690 M61T probably benign Het
Pcdhb11 T A 18: 37,422,619 I334K probably damaging Het
Pcdhb4 T C 18: 37,309,452 L605P probably damaging Het
Pced1a G T 2: 130,422,059 H224Q probably damaging Het
Pde6b C A 5: 108,427,142 S623* probably null Het
Pgr T C 9: 8,946,882 L708P probably damaging Het
Pnpla1 T C 17: 28,878,481 I207T possibly damaging Het
Prkag3 A T 1: 74,747,266 D173E probably benign Het
Prrt4 A G 6: 29,176,517 F270L probably benign Het
Ptdss2 C A 7: 141,153,084 P260Q possibly damaging Het
Rftn1 T A 17: 50,047,407 N309I probably damaging Het
Rgs12 T C 5: 35,025,943 V978A possibly damaging Het
Rnf111 T C 9: 70,440,843 Y816C probably damaging Het
Rnf208 C T 2: 25,243,314 P7S probably damaging Het
Rnf24 T C 2: 131,313,295 D4G probably damaging Het
Ryr2 T A 13: 11,555,463 I4925L probably benign Het
S1pr5 A T 9: 21,245,082 V16D possibly damaging Het
Scgb1b24 A G 7: 33,744,141 D75G possibly damaging Het
Setdb2 A T 14: 59,423,345 C116* probably null Het
Sh3rf2 G A 18: 42,101,539 R129Q probably damaging Het
Spata31d1d C T 13: 59,727,193 V843I probably benign Het
Steap3 A C 1: 120,241,518 F350V probably benign Het
Tecrl T A 5: 83,355,068 probably benign Het
Tex15 T A 8: 33,576,562 S2007T possibly damaging Het
Tomm7 C A 5: 23,844,157 probably benign Het
Trpv1 A C 11: 73,244,204 N409T possibly damaging Het
Try5 T A 6: 41,311,365 Y218F probably benign Het
Tspan5 A T 3: 138,898,122 I196F possibly damaging Het
Wdhd1 A T 14: 47,251,948 C709* probably null Het
Other mutations in Hectd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Hectd3 APN 4 117000588 splice site probably benign
IGL00227:Hectd3 APN 4 117000587 splice site probably benign
IGL00227:Hectd3 APN 4 117000589 splice site probably benign
IGL00987:Hectd3 APN 4 116999643 missense probably damaging 0.98
IGL01402:Hectd3 APN 4 116996065 missense probably damaging 0.96
IGL01660:Hectd3 APN 4 116996372 missense possibly damaging 0.91
IGL02397:Hectd3 APN 4 117003136 missense possibly damaging 0.94
IGL03029:Hectd3 APN 4 116996965 nonsense probably null
chopstix2 UTSW 4 116996396 missense probably benign 0.08
R0147:Hectd3 UTSW 4 116997040 unclassified probably benign
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0240:Hectd3 UTSW 4 117002613 missense probably damaging 0.97
R0611:Hectd3 UTSW 4 116996044 missense possibly damaging 0.67
R1367:Hectd3 UTSW 4 116997170 missense probably null 0.48
R1401:Hectd3 UTSW 4 117002269 missense possibly damaging 0.52
R1444:Hectd3 UTSW 4 116996396 missense probably benign 0.08
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1466:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1517:Hectd3 UTSW 4 117002994 missense probably damaging 0.96
R1584:Hectd3 UTSW 4 116996566 missense probably damaging 0.98
R1593:Hectd3 UTSW 4 116997020 missense possibly damaging 0.86
R1628:Hectd3 UTSW 4 116997392 missense probably damaging 1.00
R1669:Hectd3 UTSW 4 116999643 missense probably damaging 0.98
R1731:Hectd3 UTSW 4 116996455 critical splice donor site probably null
R1918:Hectd3 UTSW 4 117000343 missense possibly damaging 0.68
R2029:Hectd3 UTSW 4 117000685 missense probably damaging 0.99
R2174:Hectd3 UTSW 4 116999701 missense probably benign 0.04
R2184:Hectd3 UTSW 4 117000903 missense possibly damaging 0.93
R2226:Hectd3 UTSW 4 116995689 missense possibly damaging 0.67
R3721:Hectd3 UTSW 4 116999745 missense probably benign 0.08
R3895:Hectd3 UTSW 4 116996089 missense probably damaging 1.00
R3937:Hectd3 UTSW 4 116998530 missense probably benign 0.28
R4291:Hectd3 UTSW 4 116995692 missense probably damaging 1.00
R4729:Hectd3 UTSW 4 116997218 missense probably damaging 0.98
R4837:Hectd3 UTSW 4 117002597 missense probably null 0.32
R5059:Hectd3 UTSW 4 116997164 missense possibly damaging 0.93
R5090:Hectd3 UTSW 4 117000238 splice site probably benign
R5910:Hectd3 UTSW 4 117002134 missense probably benign 0.09
R5932:Hectd3 UTSW 4 117002273 missense possibly damaging 0.79
R6182:Hectd3 UTSW 4 117000279 missense probably damaging 1.00
R6292:Hectd3 UTSW 4 116998808 missense probably damaging 1.00
R6405:Hectd3 UTSW 4 117000624 missense probably benign 0.04
R6478:Hectd3 UTSW 4 116999586 missense probably damaging 1.00
R7471:Hectd3 UTSW 4 116996588 missense probably benign 0.01
R8053:Hectd3 UTSW 4 117000858 missense possibly damaging 0.65
R8671:Hectd3 UTSW 4 116996581 missense possibly damaging 0.67
R8840:Hectd3 UTSW 4 116998407 missense probably benign 0.14
Z1177:Hectd3 UTSW 4 116998760 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGCTAGGTCCAGAACTCCC -3'
(R):5'- TCCTGAGGACCCAGAGTATG -3'

Sequencing Primer
(F):5'- GCTAGGTCCAGAACTCCCATCAC -3'
(R):5'- GTATCTGAATGAGTCTCTAGGCACC -3'
Posted On 2019-10-07