Incidental Mutation 'R7534:Ufsp2'
ID583453
Institutional Source Beutler Lab
Gene Symbol Ufsp2
Ensembl Gene ENSMUSG00000031634
Gene NameUFM1-specific peptidase 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7534 (G1)
Quality Score192.009
Status Validated
Chromosome8
Chromosomal Location45975528-45996958 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45980324 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 25 (I25N)
Ref Sequence ENSEMBL: ENSMUSP00000034051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034051] [ENSMUST00000123307] [ENSMUST00000130412] [ENSMUST00000150943] [ENSMUST00000209443] [ENSMUST00000210081]
PDB Structure
Ubiquitin-fold modifier 1 Specific Protease, UfSP2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000034051
AA Change: I25N

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000034051
Gene: ENSMUSG00000031634
AA Change: I25N

DomainStartEndE-ValueType
low complexity region 87 103 N/A INTRINSIC
Pfam:Peptidase_C78 268 453 1.3e-56 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000123307
AA Change: I25N

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000130412
AA Change: I25N

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000150943
AA Change: I25N

PolyPhen 2 Score 0.342 (Sensitivity: 0.90; Specificity: 0.89)
Predicted Effect unknown
Transcript: ENSMUST00000209443
AA Change: I25N
Predicted Effect possibly damaging
Transcript: ENSMUST00000210081
AA Change: I25N

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a highly conserved cysteine protease. The protein cleaves two C-terminal residues from ubiquitin-fold modifier 1, a ubiquitin-like post-translational modifier protein. Activation of ubiquitin-fold modifier 1 by the encoded protein exposes a C-terminal glycine residue that allows interaction with other proteins and transfer to its target protein. An allelic variant of this gene has been associated with Beukes hip dysplasia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,741,023 R993Q probably benign Het
Aif1 A C 17: 35,171,414 M120R possibly damaging Het
Ank2 T C 3: 126,934,333 probably null Het
Ankrd11 A T 8: 122,894,410 I901N probably damaging Het
Apc T C 18: 34,316,962 S2304P probably damaging Het
AW551984 A T 9: 39,591,481 C632S probably benign Het
Bicra T C 7: 15,971,935 N1527S probably damaging Het
Cacna1d A G 14: 30,079,362 L1363P probably damaging Het
Cacna1g G A 11: 94,411,078 P2037S probably benign Het
Cdc27 A G 11: 104,508,414 L724S probably damaging Het
Cttnbp2 C T 6: 18,420,765 probably null Het
Dchs1 G A 7: 105,772,373 A280V probably benign Het
Dclk3 G A 9: 111,468,218 G277R probably benign Het
Ddr1 A G 17: 35,682,622 probably null Het
Dnah7c A C 1: 46,770,067 D3515A probably damaging Het
Elovl4 G A 9: 83,790,119 T49M probably damaging Het
Fam13b A T 18: 34,498,007 F40I probably damaging Het
Fancd2os T C 6: 113,597,640 H135R probably benign Het
Fer1l6 A G 15: 58,638,026 I1446V probably damaging Het
Fyb2 T A 4: 104,999,348 Y584* probably null Het
Galnt16 A T 12: 80,597,135 L442F probably damaging Het
Garem1 T A 18: 21,299,916 probably benign Het
Ggta1 C T 2: 35,402,428 R289Q probably damaging Het
Gm11564 T C 11: 99,815,521 T28A unknown Het
Hcn1 A G 13: 117,975,425 T642A unknown Het
Hhat A T 1: 192,726,304 L173H probably damaging Het
Hook1 T G 4: 96,017,597 I585S probably benign Het
Ighg1 A T 12: 113,329,729 S114T Het
Kmt2d G A 15: 98,852,018 P2598L unknown Het
Macc1 A T 12: 119,447,519 H674L probably benign Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Olfr1012 A C 2: 85,759,459 L306V probably benign Het
Olfr134 T A 17: 38,175,297 M71K probably benign Het
Olfr862 A G 9: 19,884,176 V43A probably benign Het
Pnliprp2 T A 19: 58,775,142 S408T probably benign Het
Ppara A C 15: 85,777,726 Y56S probably benign Het
Ppp1r1a A G 15: 103,532,389 C114R probably benign Het
Pycard C T 7: 127,993,485 V57I probably damaging Het
Rin3 T G 12: 102,350,941 Y143D unknown Het
Slc12a7 A G 13: 73,764,068 probably benign Het
Slitrk3 C T 3: 73,050,107 R444H probably damaging Het
Ttf2 C T 3: 100,950,412 probably null Het
Uqcrc2 A G 7: 120,641,689 T115A possibly damaging Het
Vmn2r43 T A 7: 8,255,231 R328* probably null Het
Vmn2r8 T A 5: 108,802,174 Y269F possibly damaging Het
Zbtb5 T C 4: 44,995,030 Y118C probably damaging Het
Zeb1 T C 18: 5,766,611 V374A probably damaging Het
Other mutations in Ufsp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02092:Ufsp2 APN 8 45995664 critical splice donor site probably null
IGL02122:Ufsp2 APN 8 45995648 missense probably benign 0.01
IGL02523:Ufsp2 APN 8 45983548 missense probably damaging 1.00
IGL03031:Ufsp2 APN 8 45984100 missense probably damaging 1.00
R0317:Ufsp2 UTSW 8 45992233 critical splice donor site probably null
R0523:Ufsp2 UTSW 8 45996743 missense probably benign 0.00
R0538:Ufsp2 UTSW 8 45992150 missense probably damaging 1.00
R0661:Ufsp2 UTSW 8 45979233 start codon destroyed probably null 1.00
R3927:Ufsp2 UTSW 8 45983686 splice site probably null
R4319:Ufsp2 UTSW 8 45995627 missense possibly damaging 0.95
R4355:Ufsp2 UTSW 8 45985465 missense possibly damaging 0.95
R5183:Ufsp2 UTSW 8 45994089 missense probably benign 0.18
R5473:Ufsp2 UTSW 8 45992221 missense probably damaging 1.00
R6726:Ufsp2 UTSW 8 45985467 missense probably benign 0.05
R7133:Ufsp2 UTSW 8 45983624 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTTAGAGCCACAGATGATGG -3'
(R):5'- TGAATGAAGCGCACTACGTTC -3'

Sequencing Primer
(F):5'- GCATGGAATTTATGGTCTCAGAACCC -3'
(R):5'- TACGTTCTTACAGGCAGAGC -3'
Posted On2019-10-17