Incidental Mutation 'R7534:Olfr134'
ID 583475
Institutional Source Beutler Lab
Gene Symbol Olfr134
Ensembl Gene ENSMUSG00000096009
Gene Name olfactory receptor 134
Synonyms MOR256-5, GA_x6K02T2PSCP-2623613-2624551
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.140) question?
Stock # R7534 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 38171388-38176578 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 38175297 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 71 (M71K)
Ref Sequence ENSEMBL: ENSMUSP00000151069 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074883] [ENSMUST00000215900]
AlphaFold Q8VG95
Predicted Effect probably benign
Transcript: ENSMUST00000074883
AA Change: M71K

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000074423
Gene: ENSMUSG00000096009
AA Change: M71K

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 3.4e-50 PFAM
Pfam:7tm_1 41 290 2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215900
AA Change: M71K

PolyPhen 2 Score 0.215 (Sensitivity: 0.92; Specificity: 0.88)
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik G A 1: 105,741,023 R993Q probably benign Het
Aif1 A C 17: 35,171,414 M120R possibly damaging Het
Ank2 T C 3: 126,934,333 probably null Het
Ankrd11 A T 8: 122,894,410 I901N probably damaging Het
Apc T C 18: 34,316,962 S2304P probably damaging Het
AW551984 A T 9: 39,591,481 C632S probably benign Het
Bicra T C 7: 15,971,935 N1527S probably damaging Het
Cacna1d A G 14: 30,079,362 L1363P probably damaging Het
Cacna1g G A 11: 94,411,078 P2037S probably benign Het
Cdc27 A G 11: 104,508,414 L724S probably damaging Het
Cttnbp2 C T 6: 18,420,765 probably null Het
Dchs1 G A 7: 105,772,373 A280V probably benign Het
Dclk3 G A 9: 111,468,218 G277R probably benign Het
Ddr1 A G 17: 35,682,622 probably null Het
Dnah7c A C 1: 46,770,067 D3515A probably damaging Het
Elovl4 G A 9: 83,790,119 T49M probably damaging Het
Fam13b A T 18: 34,498,007 F40I probably damaging Het
Fancd2os T C 6: 113,597,640 H135R probably benign Het
Fer1l6 A G 15: 58,638,026 I1446V probably damaging Het
Fyb2 T A 4: 104,999,348 Y584* probably null Het
Galnt16 A T 12: 80,597,135 L442F probably damaging Het
Garem1 T A 18: 21,299,916 probably benign Het
Ggta1 C T 2: 35,402,428 R289Q probably damaging Het
Gm11564 T C 11: 99,815,521 T28A unknown Het
Hcn1 A G 13: 117,975,425 T642A unknown Het
Hhat A T 1: 192,726,304 L173H probably damaging Het
Hook1 T G 4: 96,017,597 I585S probably benign Het
Ighg1 A T 12: 113,329,729 S114T Het
Kmt2d G A 15: 98,852,018 P2598L unknown Het
Macc1 A T 12: 119,447,519 H674L probably benign Het
Mypn T C 10: 63,193,131 E51G probably benign Het
Olfr1012 A C 2: 85,759,459 L306V probably benign Het
Olfr862 A G 9: 19,884,176 V43A probably benign Het
Pnliprp2 T A 19: 58,775,142 S408T probably benign Het
Ppara A C 15: 85,777,726 Y56S probably benign Het
Ppp1r1a A G 15: 103,532,389 C114R probably benign Het
Pycard C T 7: 127,993,485 V57I probably damaging Het
Rin3 T G 12: 102,350,941 Y143D unknown Het
Slc12a7 A G 13: 73,764,068 probably benign Het
Slitrk3 C T 3: 73,050,107 R444H probably damaging Het
Ttf2 C T 3: 100,950,412 probably null Het
Ufsp2 T A 8: 45,980,324 I25N probably benign Het
Uqcrc2 A G 7: 120,641,689 T115A possibly damaging Het
Vmn2r43 T A 7: 8,255,231 R328* probably null Het
Vmn2r8 T A 5: 108,802,174 Y269F possibly damaging Het
Zbtb5 T C 4: 44,995,030 Y118C probably damaging Het
Zeb1 T C 18: 5,766,611 V374A probably damaging Het
Other mutations in Olfr134
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01677:Olfr134 APN 17 38175875 missense probably damaging 1.00
IGL01749:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01750:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01751:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01753:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01757:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01765:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01766:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01767:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL01822:Olfr134 APN 17 38175448 missense probably damaging 1.00
IGL02256:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02257:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02258:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02259:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02275:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02293:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02295:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02317:Olfr134 APN 17 38175686 missense probably benign 0.04
IGL02318:Olfr134 APN 17 38175686 missense probably benign 0.04
R0230:Olfr134 UTSW 17 38175950 missense probably damaging 1.00
R0363:Olfr134 UTSW 17 38175447 missense probably damaging 1.00
R1074:Olfr134 UTSW 17 38175440 missense probably damaging 1.00
R1506:Olfr134 UTSW 17 38175200 missense probably benign
R2300:Olfr134 UTSW 17 38175550 nonsense probably null
R3743:Olfr134 UTSW 17 38175902 missense probably damaging 1.00
R3975:Olfr134 UTSW 17 38175495 missense probably benign 0.03
R4230:Olfr134 UTSW 17 38175881 missense possibly damaging 0.67
R5158:Olfr134 UTSW 17 38175454 nonsense probably null
R5439:Olfr134 UTSW 17 38176026 splice site probably null
R6144:Olfr134 UTSW 17 38175225 missense probably damaging 1.00
R6309:Olfr134 UTSW 17 38175519 missense probably benign 0.00
R6675:Olfr134 UTSW 17 38176014 missense probably benign
R6800:Olfr134 UTSW 17 38175122 missense probably benign 0.01
R6873:Olfr134 UTSW 17 38175368 missense probably benign
R7193:Olfr134 UTSW 17 38175096 missense probably benign 0.44
R7869:Olfr134 UTSW 17 38175939 missense possibly damaging 0.94
R7912:Olfr134 UTSW 17 38175267 missense probably damaging 0.99
R8048:Olfr134 UTSW 17 38175528 missense probably benign 0.11
R8305:Olfr134 UTSW 17 38175573 missense probably damaging 1.00
R9396:Olfr134 UTSW 17 38175530 missense probably damaging 1.00
R9445:Olfr134 UTSW 17 38175803 missense probably damaging 1.00
X0011:Olfr134 UTSW 17 38175851 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTGCAGACCGTCCTTG -3'
(R):5'- TTCCAGTCAGCCACACAGTG -3'

Sequencing Primer
(F):5'- AGACCGTCCTTGGCTAGAAC -3'
(R):5'- TACTAACAGGATGCAGTTGCGC -3'
Posted On 2019-10-17