Incidental Mutation 'R7540:Pus7'
ID583834
Institutional Source Beutler Lab
Gene Symbol Pus7
Ensembl Gene ENSMUSG00000057541
Gene Namepseudouridylate synthase 7
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R7540 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location23740648-23783711 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 23760246 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 304 (T304I)
Ref Sequence ENSEMBL: ENSMUSP00000114588 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119946] [ENSMUST00000131992] [ENSMUST00000148618]
Predicted Effect probably damaging
Transcript: ENSMUST00000119946
AA Change: T298I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113801
Gene: ENSMUSG00000057541
AA Change: T298I

DomainStartEndE-ValueType
low complexity region 77 99 N/A INTRINSIC
Pfam:TruD 246 641 9e-69 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000131404
AA Change: T35I

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000122033
Gene: ENSMUSG00000057541
AA Change: T35I

DomainStartEndE-ValueType
Pfam:TruD 1 184 3e-42 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000131992
AA Change: T298I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000123129
Gene: ENSMUSG00000057541
AA Change: T298I

DomainStartEndE-ValueType
low complexity region 77 99 N/A INTRINSIC
Pfam:TruD 239 641 1.3e-71 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000148618
AA Change: T304I

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000114588
Gene: ENSMUSG00000057541
AA Change: T304I

DomainStartEndE-ValueType
low complexity region 77 99 N/A INTRINSIC
Pfam:TruD 251 647 6.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000151449
SMART Domains Protein: ENSMUSP00000120575
Gene: ENSMUSG00000057541

DomainStartEndE-ValueType
low complexity region 48 70 N/A INTRINSIC
low complexity region 136 144 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 98% (48/49)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930516K23Rik T C 7: 104,059,263 E113G probably damaging Het
Adamts8 A G 9: 30,959,064 E650G probably damaging Het
Adgrg7 G A 16: 56,750,429 T412M probably damaging Het
Ank2 C T 3: 126,988,159 V7I possibly damaging Het
Bpifb1 G A 2: 154,213,111 V308M probably damaging Het
C3 A G 17: 57,206,220 S1476P probably benign Het
Dgkb A T 12: 37,981,790 probably benign Het
Fmn1 A G 2: 113,529,310 probably null Het
Foxb1 G A 9: 69,759,859 Q130* probably null Het
Gemin5 C T 11: 58,130,402 probably null Het
Ghr T A 15: 3,319,914 D594V possibly damaging Het
Gm10272 A C 10: 77,706,626 M1L unknown Het
Gm11239 C T 4: 73,668,411 probably benign Het
Gpr161 G A 1: 165,318,835 V447M probably damaging Het
Hspg2 T A 4: 137,541,440 S2157T possibly damaging Het
Irs1 A G 1: 82,288,002 V831A not run Het
Itga8 T A 2: 12,111,037 I1014L possibly damaging Het
Iws1 T A 18: 32,080,483 S321R possibly damaging Het
Kctd19 G T 8: 105,386,935 P702Q probably benign Het
Man2c1 G A 9: 57,140,275 D739N probably damaging Het
Mboat4 T A 8: 34,124,024 L205Q probably damaging Het
Meis3 C A 7: 16,177,493 Y38* probably null Het
Mroh7 G T 4: 106,720,398 T361K possibly damaging Het
Myl6b T A 10: 128,496,280 K106* probably null Het
Naaa T A 5: 92,263,724 T241S probably benign Het
Neurog3 T G 10: 62,133,977 I172S probably benign Het
Nub1 T G 5: 24,701,529 I351R probably damaging Het
Olfr328 C A 11: 58,551,631 V203L possibly damaging Het
Olfr402 A T 11: 74,155,588 R145W probably benign Het
Olfr777 A T 10: 129,269,134 F63Y probably benign Het
Osbp2 T C 11: 3,717,944 K18E probably damaging Het
Pcdh8 A T 14: 79,771,103 W7R probably benign Het
Pcsk7 G T 9: 45,927,673 probably null Het
Plin4 G A 17: 56,104,883 T716I probably damaging Het
Prkcb G A 7: 122,568,134 V356I probably damaging Het
Rmnd1 A G 10: 4,403,989 V402A probably damaging Het
Slmap T C 14: 26,460,191 E329G probably damaging Het
Sytl3 T C 17: 6,681,947 probably benign Het
Tg A G 15: 66,689,927 I1087V probably benign Het
Tmco1 A G 1: 167,326,003 T162A Het
Tti1 G A 2: 158,007,996 T441I probably benign Het
Tubgcp6 G T 15: 89,102,323 Q1366K possibly damaging Het
Ush1g T C 11: 115,318,573 K265R probably benign Het
Zdhhc8 A G 16: 18,227,810 V209A probably damaging Het
Zfp160 T A 17: 21,025,660 Y157* probably null Het
Zfp423 A T 8: 87,688,067 C1208S possibly damaging Het
Zfyve26 A T 12: 79,268,676 V1342E probably damaging Het
Zmym1 A T 4: 127,048,757 C613S probably benign Het
Other mutations in Pus7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01301:Pus7 APN 5 23746424 critical splice donor site probably null
IGL01690:Pus7 APN 5 23775964 missense probably damaging 1.00
IGL01813:Pus7 APN 5 23760304 splice site probably benign
IGL02257:Pus7 APN 5 23762461 missense probably damaging 1.00
IGL02892:Pus7 APN 5 23754556 missense probably damaging 1.00
ANU18:Pus7 UTSW 5 23746424 critical splice donor site probably null
R0010:Pus7 UTSW 5 23747845 missense probably benign 0.01
R0139:Pus7 UTSW 5 23778092 missense probably damaging 0.99
R0219:Pus7 UTSW 5 23775966 missense possibly damaging 0.48
R1127:Pus7 UTSW 5 23768795 missense probably benign 0.04
R1655:Pus7 UTSW 5 23747800 nonsense probably null
R1795:Pus7 UTSW 5 23741916 missense probably damaging 1.00
R1906:Pus7 UTSW 5 23778211 missense probably damaging 0.98
R4379:Pus7 UTSW 5 23748866 intron probably benign
R4430:Pus7 UTSW 5 23746489 missense probably benign 0.30
R4431:Pus7 UTSW 5 23746489 missense probably benign 0.30
R5569:Pus7 UTSW 5 23748834 missense probably benign 0.01
R6854:Pus7 UTSW 5 23768847 synonymous silent
R7051:Pus7 UTSW 5 23775679 missense probably damaging 0.98
R7238:Pus7 UTSW 5 23778452 missense probably benign 0.00
R7278:Pus7 UTSW 5 23752344 missense probably damaging 0.99
R7297:Pus7 UTSW 5 23741910 missense probably damaging 1.00
R7650:Pus7 UTSW 5 23760246 missense probably damaging 0.99
X0013:Pus7 UTSW 5 23752275 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTGTTTCCTAGGTGAATGTTAAAGGAC -3'
(R):5'- AAAGGCTCTGACTCAAGCCC -3'

Sequencing Primer
(F):5'- TTTCTGAGTCCAATCCAAAGGAGG -3'
(R):5'- ACTCAAGCCCTGCCGAGAG -3'
Posted On2019-10-17