Incidental Mutation 'R7567:Agr2'
ID585540
Institutional Source Beutler Lab
Gene Symbol Agr2
Ensembl Gene ENSMUSG00000020581
Gene Nameanterior gradient 2
SynonymsXAG-2, mAG-2, Gob-4, HAG-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.590) question?
Stock #R7567 (G1)
Quality Score225.009
Status Not validated
Chromosome12
Chromosomal Location35992907-36004087 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 35995947 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 64 (R64S)
Ref Sequence ENSEMBL: ENSMUSP00000020898 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020898]
Predicted Effect probably benign
Transcript: ENSMUST00000020898
AA Change: R64S

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000020898
Gene: ENSMUSG00000020581
AA Change: R64S

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
Pfam:Thioredoxin_7 53 133 1.9e-26 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disulfide isomerase (PDI) family of endoplasmic reticulum (ER) proteins that catalyze protein folding and thiol-disulfide interchange reactions. The encoded protein has an N-terminal ER-signal sequence, a catalytically active thioredoxin domain, and a C-terminal ER-retention sequence. This protein plays a role in cell migration, cellular transformation and metastasis and is as a p53 inhibitor. As an ER-localized molecular chaperone, it plays a role in the folding, trafficking, and assembly of cysteine-rich transmembrane receptors and the cysteine-rich intestinal gylcoprotein mucin. This gene has been implicated in inflammatory bowel disease and cancer progression. [provided by RefSeq, Mar 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit colitis and increased susceptibility to induced colitis. Mice homozygous for another knock-out allele exhibit hyperplasia and defective lineage maturation in the stomach that leads to intestinal obstruction and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700010I14Rik A T 17: 9,008,006 Q464H probably damaging Het
1810041L15Rik G A 15: 84,406,713 T131M probably benign Het
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Abcc5 A T 16: 20,405,510 S108T probably damaging Het
Acss3 T C 10: 107,123,313 S91G probably benign Het
Adgrf4 T A 17: 42,667,442 I337L probably benign Het
Adgrv1 A G 13: 81,433,529 S4799P probably benign Het
Adgrv1 T C 13: 81,579,477 D348G probably damaging Het
Afdn A G 17: 13,888,808 D1546G probably benign Het
Ankrd13a T A 5: 114,789,484 probably null Het
Apon T A 10: 128,255,053 M200K possibly damaging Het
Art4 T C 6: 136,854,430 S238G possibly damaging Het
Atp2a2 A T 5: 122,491,784 V74D probably benign Het
Atrnl1 T C 19: 57,699,523 S807P probably damaging Het
B020004J07Rik T C 4: 101,837,134 N184S probably benign Het
C2cd3 T C 7: 100,430,815 V936A Het
Car15 T A 16: 17,836,788 H122L probably damaging Het
Cav3 A T 6: 112,472,467 R149W probably benign Het
Ccdc8 A T 7: 16,994,762 I59F probably damaging Het
Ccng2 G A 5: 93,270,872 V119I probably benign Het
Ceacam2 A G 7: 25,527,908 I178T probably benign Het
Ces2a A G 8: 104,741,298 D520G probably benign Het
Cln8 T C 8: 14,895,057 S124P probably benign Het
Coro2a T A 4: 46,546,674 D227V probably damaging Het
Cpa4 A C 6: 30,573,890 R32S probably benign Het
Creb3l4 G T 3: 90,242,422 D45E probably benign Het
Crybb2 C T 5: 113,065,893 probably null Het
Cul7 T A 17: 46,654,595 H566Q probably benign Het
Cyp2b10 A G 7: 25,914,779 Y226C probably damaging Het
Dennd2a A T 6: 39,522,809 V274D probably benign Het
Dmbt1 G A 7: 131,061,363 probably null Het
Drc7 T C 8: 95,068,056 I363T probably benign Het
Drd3 G A 16: 43,822,684 V396I probably benign Het
Eif2ak4 A G 2: 118,450,314 N1054S probably benign Het
Epc1 A C 18: 6,450,084 V458G probably damaging Het
Exoc1 T A 5: 76,537,715 D91E probably damaging Het
Fat4 T A 3: 38,889,336 F793I probably damaging Het
Fhod1 T C 8: 105,347,837 E6G unknown Het
Galnt16 G A 12: 80,581,310 probably null Het
Ganc A T 2: 120,456,101 T804S probably benign Het
Gpam A T 19: 55,081,630 V398E possibly damaging Het
Gpr68 A G 12: 100,878,364 V307A probably benign Het
Grm7 C T 6: 111,358,761 S711L probably damaging Het
Hemgn T A 4: 46,397,034 R67S probably damaging Het
Hmg20b T C 10: 81,346,659 D281G possibly damaging Het
Ifi211 A C 1: 173,901,835 F277V probably damaging Het
Ighmbp2 T C 19: 3,272,981 I322V probably benign Het
Iqce A T 5: 140,686,075 L265H probably damaging Het
Itgal G T 7: 127,299,788 A101S probably benign Het
Kif5a C T 10: 127,237,379 M647I probably benign Het
Kirrel G T 3: 87,095,681 T135K probably damaging Het
Klf16 T C 10: 80,576,788 Y138C probably benign Het
Klhl7 A G 5: 24,126,846 T49A probably benign Het
Mr1 T C 1: 155,146,728 probably benign Het
Mrc1 A T 2: 14,325,293 I1238F probably damaging Het
Ncoa5 C T 2: 165,004,251 M225I possibly damaging Het
Nf1 A T 11: 79,547,226 T121S probably damaging Het
Ngfr T C 11: 95,574,321 T234A probably benign Het
Ninj1 T G 13: 49,193,880 F74V probably damaging Het
Npffr1 T C 10: 61,626,309 V408A probably benign Het
Nsd2 T C 5: 33,846,226 V240A probably damaging Het
Olfr103 T A 17: 37,337,171 E20D probably benign Het
Olfr1351 T A 10: 79,017,545 F74L probably benign Het
Olfr30 A G 11: 58,455,166 M261T probably damaging Het
Olfr907 G A 9: 38,499,073 V135I probably benign Het
Olfr954 T C 9: 39,461,877 S146P possibly damaging Het
Ovol1 T C 19: 5,551,586 H136R probably damaging Het
Prag1 T A 8: 36,102,606 D114E possibly damaging Het
Prss57 T A 10: 79,787,400 H71L probably benign Het
Ptgs2 T C 1: 150,102,697 F187L probably damaging Het
Ptprz1 A T 6: 22,959,780 N92I probably damaging Het
Rab23 A T 1: 33,734,731 T91S possibly damaging Het
Rag1 A G 2: 101,643,661 S379P probably damaging Het
Ribc2 G T 15: 85,143,247 D310Y probably damaging Het
Rims1 A G 1: 22,468,210 Y620H probably damaging Het
Rnf219 T C 14: 104,479,378 T520A probably damaging Het
Rock1 A C 18: 10,090,820 V938G probably benign Het
Rsph10b A G 5: 143,949,426 N314S possibly damaging Het
Sertad1 A G 7: 27,489,902 D216G possibly damaging Het
Slco6d1 T A 1: 98,497,527 V600D probably damaging Het
Snapc2 T C 8: 4,255,314 I232T probably damaging Het
Snx13 A G 12: 35,086,914 S125G probably damaging Het
Srcin1 C T 11: 97,534,725 R502H probably damaging Het
Tesmin A G 19: 3,392,218 E167G possibly damaging Het
Tex10 T C 4: 48,468,787 I129M possibly damaging Het
Tmem235 A G 11: 117,864,141 S140G probably benign Het
Trim60 T A 8: 65,001,525 D24V probably damaging Het
Ttc39c A G 18: 12,689,879 E148G probably benign Het
Vmn2r70 G T 7: 85,565,035 T303K probably benign Het
Wdr48 A T 9: 119,916,828 T426S possibly damaging Het
Wdr60 A T 12: 116,254,510 probably null Het
Xirp2 A T 2: 67,515,982 T2856S probably benign Het
Zswim8 A G 14: 20,719,933 N1356S probably damaging Het
Other mutations in Agr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Agr2 APN 12 35995581 missense possibly damaging 0.63
IGL02081:Agr2 APN 12 35995656 critical splice donor site probably null
IGL03190:Agr2 APN 12 35998635 missense probably damaging 1.00
IGL02835:Agr2 UTSW 12 35995904 missense probably benign 0.23
R5514:Agr2 UTSW 12 35996091 missense probably benign
R5894:Agr2 UTSW 12 35995510 splice site probably benign
R6196:Agr2 UTSW 12 35995592 nonsense probably null
R6584:Agr2 UTSW 12 35995626 missense probably benign
R6585:Agr2 UTSW 12 35995626 missense probably benign
R6850:Agr2 UTSW 12 35995559 missense probably benign
R7384:Agr2 UTSW 12 35995924 missense probably damaging 0.98
R7459:Agr2 UTSW 12 35997453 missense probably benign 0.20
R7533:Agr2 UTSW 12 35996129 critical splice donor site probably null
R8039:Agr2 UTSW 12 35995559 missense probably benign 0.10
R8118:Agr2 UTSW 12 35996107 missense probably benign 0.45
Predicted Primers PCR Primer
(F):5'- ATCCCTGACTCTTGGTGTCGTG -3'
(R):5'- GGGCATTCGTCCAAGTGATG -3'

Sequencing Primer
(F):5'- CCTAGATTTAGCCGTTTATAATCAGG -3'
(R):5'- TCGTCCAAGTGATGAATGACC -3'
Posted On2019-10-17