Incidental Mutation 'R7616:Vangl1'
ID 588903
Institutional Source Beutler Lab
Gene Symbol Vangl1
Ensembl Gene ENSMUSG00000027860
Gene Name VANGL planar cell polarity 1
Synonyms stbm, KITENIN, Lpp2, mStbm
MMRRC Submission 045716-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.304) question?
Stock # R7616 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 102060899-102112009 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 102091381 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Asparagine at position 235 (I235N)
Ref Sequence ENSEMBL: ENSMUSP00000029453 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029453] [ENSMUST00000159388] [ENSMUST00000159586] [ENSMUST00000168312]
AlphaFold Q80Z96
Predicted Effect probably damaging
Transcript: ENSMUST00000029453
AA Change: I235N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000029453
Gene: ENSMUSG00000027860
AA Change: I235N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 360 3.4e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159388
AA Change: I235N

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125043
Gene: ENSMUSG00000027860
AA Change: I235N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 25 526 8.6e-262 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159586
SMART Domains Protein: ENSMUSP00000124874
Gene: ENSMUSG00000027860

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 137 3.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168312
AA Change: I235N

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000126254
Gene: ENSMUSG00000027860
AA Change: I235N

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 357 1.2e-170 PFAM
Pfam:Strabismus 354 476 9.5e-67 PFAM
Meta Mutation Damage Score 0.3679 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal orientation of cochlear hair cell stereociliary bundles but do not develop neural tube or cardiac outflow tract abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930563M21Rik A G 9: 55,896,738 (GRCm39) F290S probably benign Het
4931414P19Rik T C 14: 54,823,123 (GRCm39) D358G probably damaging Het
A630089N07Rik T A 16: 97,867,410 (GRCm39) Q184L probably damaging Het
Adam10 A G 9: 70,629,993 (GRCm39) R142G possibly damaging Het
Adgrb1 A G 15: 74,420,418 (GRCm39) T856A probably damaging Het
Angel1 A G 12: 86,764,510 (GRCm39) S493P probably benign Het
Arid1b C G 17: 5,045,661 (GRCm39) P150A unknown Het
Atp8b5 T A 4: 43,370,823 (GRCm39) probably null Het
Cbfa2t3 T G 8: 123,360,076 (GRCm39) Q525P possibly damaging Het
Clip4 T C 17: 72,141,268 (GRCm39) Y541H probably benign Het
Cracr2a C T 6: 127,585,660 (GRCm39) Q153* probably null Het
Dsp G T 13: 38,375,458 (GRCm39) C1081F probably damaging Het
Dysf A G 6: 84,078,945 (GRCm39) D708G probably benign Het
Eif3d A T 15: 77,845,886 (GRCm39) D378E probably damaging Het
Etv1 T A 12: 38,915,605 (GRCm39) M424K probably damaging Het
Fam120b T G 17: 15,623,098 (GRCm39) S359A possibly damaging Het
Ffar2 A G 7: 30,519,357 (GRCm39) L61P probably damaging Het
Grm5 A T 7: 87,765,409 (GRCm39) D879V probably benign Het
Itpr3 C A 17: 27,307,951 (GRCm39) A246E probably damaging Het
Kmt2b G T 7: 30,281,633 (GRCm39) P1207Q probably damaging Het
Mamdc2 T A 19: 23,328,168 (GRCm39) Y400F probably damaging Het
Mtcl3 T C 10: 29,022,574 (GRCm39) probably benign Het
Muc4 T A 16: 32,574,161 (GRCm39) Y746* probably null Het
Mylk T C 16: 34,699,927 (GRCm39) F430S probably damaging Het
Nek10 G A 14: 14,937,759 (GRCm38) C826Y probably benign Het
Nf1 T A 11: 79,275,092 (GRCm39) F51Y probably damaging Het
Or10ag55-ps1 T C 2: 87,115,617 (GRCm39) *328Q probably null Het
Phf2 T A 13: 48,961,083 (GRCm39) Y869F unknown Het
Psmb7 T C 2: 38,523,976 (GRCm39) Y133C possibly damaging Het
Ptcd2 G A 13: 99,481,207 (GRCm39) probably benign Het
Rictor C T 15: 6,801,635 (GRCm39) S441L probably benign Het
Slbp A T 5: 33,801,210 (GRCm39) I167N probably damaging Het
Slc2a2 A G 3: 28,781,260 (GRCm39) T433A probably benign Het
Snap91 T A 9: 86,721,674 (GRCm39) N55I probably damaging Het
Stat4 A T 1: 52,053,037 (GRCm39) K73* probably null Het
Sult2a5 G A 7: 13,404,607 (GRCm39) M281I probably benign Het
Tenm3 A T 8: 48,794,084 (GRCm39) M647K possibly damaging Het
Trim66 T A 7: 109,082,956 (GRCm39) D162V probably damaging Het
Vmn1r175 T A 7: 23,508,031 (GRCm39) I199F possibly damaging Het
Vmn1r72 A G 7: 11,404,272 (GRCm39) S59P probably damaging Het
Wdr25 G A 12: 108,958,819 (GRCm39) G344S possibly damaging Het
Zfand2a A T 5: 139,464,321 (GRCm39) N61K probably damaging Het
Other mutations in Vangl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Vangl1 APN 3 102,065,545 (GRCm39) utr 3 prime probably benign
IGL00870:Vangl1 APN 3 102,096,756 (GRCm39) missense probably damaging 1.00
IGL01533:Vangl1 APN 3 102,070,667 (GRCm39) missense possibly damaging 0.88
IGL01981:Vangl1 APN 3 102,091,607 (GRCm39) missense probably damaging 1.00
IGL02792:Vangl1 APN 3 102,070,739 (GRCm39) missense probably damaging 0.98
IGL02800:Vangl1 APN 3 102,070,611 (GRCm39) splice site probably benign
IGL02942:Vangl1 APN 3 102,091,347 (GRCm39) missense probably damaging 1.00
IGL03029:Vangl1 APN 3 102,091,400 (GRCm39) missense probably damaging 1.00
R0600:Vangl1 UTSW 3 102,074,253 (GRCm39) missense probably damaging 1.00
R0904:Vangl1 UTSW 3 102,091,310 (GRCm39) missense probably damaging 0.99
R1230:Vangl1 UTSW 3 102,065,609 (GRCm39) missense probably benign 0.00
R1829:Vangl1 UTSW 3 102,070,782 (GRCm39) missense probably benign
R2005:Vangl1 UTSW 3 102,070,782 (GRCm39) missense probably benign
R2268:Vangl1 UTSW 3 102,104,160 (GRCm39) missense probably damaging 1.00
R4181:Vangl1 UTSW 3 102,073,097 (GRCm39) intron probably benign
R4662:Vangl1 UTSW 3 102,074,238 (GRCm39) missense probably benign 0.00
R4724:Vangl1 UTSW 3 102,091,870 (GRCm39) missense probably damaging 1.00
R4755:Vangl1 UTSW 3 102,065,608 (GRCm39) missense probably benign 0.19
R5548:Vangl1 UTSW 3 102,091,762 (GRCm39) missense possibly damaging 0.76
R5740:Vangl1 UTSW 3 102,091,450 (GRCm39) missense probably damaging 0.99
R5758:Vangl1 UTSW 3 102,091,408 (GRCm39) missense probably damaging 1.00
R6150:Vangl1 UTSW 3 102,091,835 (GRCm39) missense probably damaging 1.00
R6373:Vangl1 UTSW 3 102,065,764 (GRCm39) missense probably benign
R6943:Vangl1 UTSW 3 102,073,097 (GRCm39) intron probably benign
R7474:Vangl1 UTSW 3 102,091,565 (GRCm39) missense probably benign 0.22
R8120:Vangl1 UTSW 3 102,070,758 (GRCm39) nonsense probably null
R8827:Vangl1 UTSW 3 102,070,736 (GRCm39) missense probably damaging 0.99
R8859:Vangl1 UTSW 3 102,065,758 (GRCm39) missense
R9494:Vangl1 UTSW 3 102,070,665 (GRCm39) missense probably damaging 0.98
R9745:Vangl1 UTSW 3 102,072,669 (GRCm39) critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- CCCTGCCGACTAATAACATCTG -3'
(R):5'- ATTCTGCTCATCGGAACCTG -3'

Sequencing Primer
(F):5'- GCCGACTAATAACATCTGTCTTCTAG -3'
(R):5'- TTTTCTTCCGCAAGCAAAGAGC -3'
Posted On 2019-10-24