Incidental Mutation 'R6150:Vangl1'
ID489174
Institutional Source Beutler Lab
Gene Symbol Vangl1
Ensembl Gene ENSMUSG00000027860
Gene NameVANGL planar cell polarity 1
SynonymsmStbm, stbm, Lpp2, KITENIN
MMRRC Submission 044297-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.461) question?
Stock #R6150 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location102153583-102204693 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 102184519 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 84 (T84A)
Ref Sequence ENSEMBL: ENSMUSP00000124874 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029453] [ENSMUST00000159388] [ENSMUST00000159586] [ENSMUST00000168312]
Predicted Effect probably damaging
Transcript: ENSMUST00000029453
AA Change: T84A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029453
Gene: ENSMUSG00000027860
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 360 3.4e-171 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159388
AA Change: T84A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125043
Gene: ENSMUSG00000027860
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 25 526 8.6e-262 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000159586
AA Change: T84A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124874
Gene: ENSMUSG00000027860
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 137 3.5e-41 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000168312
AA Change: T84A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000126254
Gene: ENSMUSG00000027860
AA Change: T84A

DomainStartEndE-ValueType
low complexity region 5 21 N/A INTRINSIC
Pfam:Strabismus 23 357 1.2e-170 PFAM
Pfam:Strabismus 354 476 9.5e-67 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.9%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tretraspanin family. The encoded protein may be involved in mediating intestinal trefoil factor induced wound healing in the intestinal mucosa. Mutations in this gene are associated with neural tube defects. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Feb 2010]
PHENOTYPE: Mice homozygous for a gene trapped allele display abnormal orientation of cochlear hair cell stereociliary bundles but do not develop neural tube or cardiac outflow tract abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aldh3a1 A G 11: 61,213,508 T74A probably benign Het
Arhgef1 T C 7: 24,919,357 probably null Het
Art1 C G 7: 102,107,087 R162G probably benign Het
Boll T A 1: 55,270,653 I280F possibly damaging Het
Cep44 T C 8: 56,539,805 E258G probably benign Het
Cutc T A 19: 43,759,889 V75E probably damaging Het
Dtx1 T C 5: 120,681,363 K590R probably damaging Het
Eps8 A T 6: 137,517,174 D295E probably damaging Het
Erc2 C A 14: 28,141,291 S491Y probably damaging Het
F2rl3 G T 8: 72,762,738 A198S probably benign Het
Fam83b G A 9: 76,492,357 T488M probably damaging Het
Fitm2 A G 2: 163,470,074 L73P probably damaging Het
Fxyd1 T C 7: 31,054,803 probably null Het
Gm17186 T C 14: 51,680,726 noncoding transcript Het
Hivep3 C A 4: 119,734,077 S94* probably null Het
Ifna1 T A 4: 88,850,112 M9K probably null Het
Igsf11 G A 16: 39,023,349 E275K probably damaging Het
Itga1 G A 13: 114,968,233 L1086F probably benign Het
Itgav T C 2: 83,776,436 S374P probably benign Het
Jmy A T 13: 93,441,133 N842K probably benign Het
Kcnh6 G A 11: 106,020,731 V595M possibly damaging Het
Kif13b T A 14: 64,751,639 I823N probably damaging Het
Kif26b T C 1: 178,915,546 L1069P probably damaging Het
Kl T A 5: 150,988,853 M689K possibly damaging Het
Kmt2b G T 7: 30,588,477 probably benign Het
Map10 G A 8: 125,671,589 D574N probably damaging Het
Mau2 A T 8: 70,019,837 H565Q probably benign Het
Myb A G 10: 21,141,769 I641T probably damaging Het
Naaladl2 C A 3: 24,552,050 G15V probably null Het
Olfr370 G A 8: 83,541,153 C3Y probably benign Het
Olfr399 A C 11: 74,054,319 S147A probably benign Het
Olfr800 A G 10: 129,659,934 I43V probably benign Het
Olfr867 A T 9: 20,054,874 N78K probably benign Het
Otog A G 7: 46,264,059 E772G possibly damaging Het
Pla2g4d T C 2: 120,269,564 D674G probably damaging Het
Pmpcb A G 5: 21,737,139 probably null Het
Pomk A G 8: 25,983,256 V223A possibly damaging Het
Prpf40a T C 2: 53,157,915 M197V probably benign Het
Serpina1e A G 12: 103,950,807 V201A probably benign Het
Six5 C T 7: 19,097,521 P646S probably benign Het
Slc17a9 A G 2: 180,737,628 I298V probably benign Het
Slc37a2 G T 9: 37,238,347 T188K probably damaging Het
Slc6a11 T A 6: 114,245,618 F525I probably benign Het
Slit2 A T 5: 48,304,174 D1504V probably damaging Het
Srcap T A 7: 127,534,828 M907K probably damaging Het
Sspo T C 6: 48,486,379 L3746P probably benign Het
Supv3l1 A T 10: 62,435,722 N376K possibly damaging Het
Tekt3 A T 11: 63,094,657 T430S possibly damaging Het
Tex2 A T 11: 106,567,080 V508D probably benign Het
Tmem184c G T 8: 77,596,440 Q598K probably benign Het
Ube2v1 G A 2: 167,617,954 R42* probably null Het
Usp45 A C 4: 21,810,797 D331A probably damaging Het
Vgll3 T A 16: 65,828,178 probably null Het
Vmn1r61 T A 7: 5,610,679 H212L probably benign Het
Vmn2r114 A G 17: 23,291,295 V737A probably benign Het
Vmn2r35 A T 7: 7,786,556 D727E probably damaging Het
Vps18 T A 2: 119,297,592 Y965* probably null Het
Zfp521 A T 18: 13,844,078 C1093S probably damaging Het
Zfp971 A C 2: 178,033,454 H282P probably benign Het
Other mutations in Vangl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00640:Vangl1 APN 3 102158229 utr 3 prime probably benign
IGL00870:Vangl1 APN 3 102189440 missense probably damaging 1.00
IGL01533:Vangl1 APN 3 102163351 missense possibly damaging 0.88
IGL01981:Vangl1 APN 3 102184291 missense probably damaging 1.00
IGL02792:Vangl1 APN 3 102163423 missense probably damaging 0.98
IGL02800:Vangl1 APN 3 102163295 splice site probably benign
IGL02942:Vangl1 APN 3 102184031 missense probably damaging 1.00
IGL03029:Vangl1 APN 3 102184084 missense probably damaging 1.00
R0600:Vangl1 UTSW 3 102166937 missense probably damaging 1.00
R0904:Vangl1 UTSW 3 102183994 missense probably damaging 0.99
R1230:Vangl1 UTSW 3 102158293 missense probably benign 0.00
R1829:Vangl1 UTSW 3 102163466 missense probably benign
R2005:Vangl1 UTSW 3 102163466 missense probably benign
R2268:Vangl1 UTSW 3 102196844 missense probably damaging 1.00
R4181:Vangl1 UTSW 3 102165781 intron probably benign
R4662:Vangl1 UTSW 3 102166922 missense probably benign 0.00
R4724:Vangl1 UTSW 3 102184554 missense probably damaging 1.00
R4755:Vangl1 UTSW 3 102158292 missense probably benign 0.19
R5548:Vangl1 UTSW 3 102184446 missense possibly damaging 0.76
R5740:Vangl1 UTSW 3 102184134 missense probably damaging 0.99
R5758:Vangl1 UTSW 3 102184092 missense probably damaging 1.00
R6373:Vangl1 UTSW 3 102158448 missense probably benign
R6943:Vangl1 UTSW 3 102165781 intron probably benign
R7474:Vangl1 UTSW 3 102184249 missense probably benign 0.22
R7616:Vangl1 UTSW 3 102184065 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAATGGCGCCACAGGGTTTC -3'
(R):5'- TTTCTGGGTTCAAAGGGCAAAC -3'

Sequencing Primer
(F):5'- GCCACAGGGTTTCAGCTC -3'
(R):5'- TGGCGAAAATTTCAATGAAAATAGC -3'
Posted On2017-10-10