Incidental Mutation 'R7769:Fam129b'
ID598439
Institutional Source Beutler Lab
Gene Symbol Fam129b
Ensembl Gene ENSMUSG00000026796
Gene Namefamily with sequence similarity 129, member B
Synonyms9130404D14Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R7769 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location32876114-32925254 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32919832 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 314 (T314A)
Ref Sequence ENSEMBL: ENSMUSP00000028135 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028135]
Predicted Effect possibly damaging
Transcript: ENSMUST00000028135
AA Change: T314A

PolyPhen 2 Score 0.927 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000028135
Gene: ENSMUSG00000026796
AA Change: T314A

DomainStartEndE-ValueType
PH 69 194 1.81e-2 SMART
low complexity region 594 607 N/A INTRINSIC
low complexity region 685 700 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc4 ACCAGCCC ACC 14: 118,615,270 probably null Het
Abhd14b T C 9: 106,451,620 Y147H probably damaging Het
Adam26b C A 8: 43,521,695 R90L probably benign Het
Agt A T 8: 124,564,550 M6K probably benign Het
Akr1c14 T C 13: 4,059,644 S5P probably benign Het
Arhgef38 A C 3: 133,149,622 S235A unknown Het
Cabp5 A G 7: 13,400,733 D31G probably benign Het
Cacna1h T A 17: 25,385,805 D1178V probably damaging Het
Ccdc88a A T 11: 29,482,381 E1199D probably damaging Het
Cd244 A T 1: 171,577,305 I242F probably benign Het
Clpb G T 7: 101,722,717 R220L probably damaging Het
Cltc C T 11: 86,719,493 R638H probably damaging Het
Cnr1 A T 4: 33,944,892 M427L probably benign Het
Ctnnbl1 C T 2: 157,737,470 probably benign Het
Epb41l2 A T 10: 25,493,573 T597S probably benign Het
Epb41l3 T C 17: 69,238,426 Y163H probably damaging Het
Fgg A G 3: 83,013,126 probably null Het
Gm37240 A T 3: 84,509,925 D162E possibly damaging Het
Gm44511 T A 6: 128,820,277 T83S probably benign Het
Gm6685 T A 11: 28,339,252 Y188F probably benign Het
Gprin2 A T 14: 34,195,613 C67S probably benign Het
Grk6 A G 13: 55,451,007 D140G probably benign Het
Hps3 T C 3: 20,018,808 probably null Het
Hspb7 T C 4: 141,424,024 V159A possibly damaging Het
Ibsp A G 5: 104,306,005 N70D probably benign Het
Ibsp A G 5: 104,310,184 N196D probably damaging Het
Igfn1 A T 1: 135,982,405 F147Y possibly damaging Het
Iqca T G 1: 90,077,810 D492A possibly damaging Het
Klhl42 T C 6: 147,091,860 L110P possibly damaging Het
Krt12 C T 11: 99,418,026 R395Q probably damaging Het
Lig4 A T 8: 9,973,629 H50Q possibly damaging Het
Mttp A C 3: 138,103,112 L730R probably damaging Het
Muc16 T A 9: 18,660,507 I239L unknown Het
Myo15 T C 11: 60,509,149 F1723L Het
Nin T C 12: 70,043,230 D1137G Het
Nsf C T 11: 103,928,839 V35M probably damaging Het
Numa1 T A 7: 101,999,000 I646K possibly damaging Het
Nwd2 A G 5: 63,804,504 N477S probably damaging Het
Olfr59 T A 11: 74,288,763 V39E probably damaging Het
P4ha3 A G 7: 100,285,717 D62G probably damaging Het
Palb2 G T 7: 122,128,415 D77E probably benign Het
Pcmtd2 T C 2: 181,851,701 V233A probably benign Het
Perm1 TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT TGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCTGAGCCTGACACGGCTTTGTCTACACCCGCCTCT 4: 156,218,068 probably benign Het
Pgr C T 9: 8,946,855 T699I possibly damaging Het
Pknox2 C A 9: 36,895,306 probably null Het
Ppp2r3d T C 9: 124,439,087 H110R Het
Psmd11 T A 11: 80,434,582 probably benign Het
Pyroxd2 T C 19: 42,747,562 N59S probably benign Het
Qser1 A T 2: 104,758,576 D1662E possibly damaging Het
Rasip1 A G 7: 45,628,815 Y180C probably damaging Het
Rbl1 T C 2: 157,191,980 S393G probably benign Het
Rtn4r C T 16: 18,151,289 P194S probably benign Het
Ryr1 C T 7: 29,098,785 G944D probably damaging Het
Scamp3 A G 3: 89,177,991 D23G probably damaging Het
Secisbp2l CTGGG C 2: 125,771,545 probably benign Het
Shcbp1 A G 8: 4,739,232 I529T probably damaging Het
Slc5a10 T A 11: 61,673,647 D502V probably damaging Het
Smad5 T C 13: 56,733,042 I323T possibly damaging Het
Spred1 T C 2: 117,177,449 S279P probably benign Het
Stag1 T A 9: 100,944,827 V949D possibly damaging Het
Stxbp3 A G 3: 108,800,828 S386P probably benign Het
Syt14 A G 1: 192,984,324 S91P unknown Het
Thpo C T 16: 20,725,651 A211T probably benign Het
Tns1 T A 1: 73,953,371 D716V probably damaging Het
Trbv26 A G 6: 41,227,547 Y8C probably benign Het
Tshr A G 12: 91,538,270 I661V probably damaging Het
Uvrag G A 7: 98,979,721 P380S probably damaging Het
Vkorc1 G T 7: 127,894,524 Y88* probably null Het
Vmn1r63 C T 7: 5,803,370 V88M probably damaging Het
Wdsub1 A G 2: 59,878,419 Y37H probably damaging Het
Zap70 A G 1: 36,770,902 D31G probably benign Het
Zc3h12d G A 10: 7,867,626 A387T probably benign Het
Zfp438 C T 18: 5,213,377 R527H possibly damaging Het
Other mutations in Fam129b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00543:Fam129b APN 2 32912471 missense probably benign 0.04
IGL01072:Fam129b APN 2 32912415 unclassified probably benign
IGL01874:Fam129b APN 2 32905767 critical splice acceptor site probably null
IGL02302:Fam129b APN 2 32921123 missense probably benign
IGL02681:Fam129b APN 2 32911390 missense probably benign 0.05
IGL03126:Fam129b APN 2 32876386 missense possibly damaging 0.95
IGL03240:Fam129b APN 2 32922097 missense probably benign 0.00
R0125:Fam129b UTSW 2 32923821 missense probably benign 0.17
R0948:Fam129b UTSW 2 32922860 missense probably damaging 1.00
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R1195:Fam129b UTSW 2 32919803 missense probably benign
R2130:Fam129b UTSW 2 32923647 missense probably benign 0.34
R2408:Fam129b UTSW 2 32923470 missense probably damaging 1.00
R4881:Fam129b UTSW 2 32922578 nonsense probably null
R5506:Fam129b UTSW 2 32920982 missense probably damaging 0.96
R5748:Fam129b UTSW 2 32919569 missense probably damaging 1.00
R5857:Fam129b UTSW 2 32909908 missense probably benign 0.28
R6011:Fam129b UTSW 2 32922865 missense probably damaging 0.99
R6088:Fam129b UTSW 2 32923123 missense probably damaging 1.00
R6720:Fam129b UTSW 2 32905826 missense probably damaging 1.00
R6763:Fam129b UTSW 2 32911448 critical splice donor site probably null
R6769:Fam129b UTSW 2 32895654
R7296:Fam129b UTSW 2 32922642 missense possibly damaging 0.74
R7888:Fam129b UTSW 2 32922125 nonsense probably null
R7971:Fam129b UTSW 2 32922125 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGGGTGTTGACAGGGAAC -3'
(R):5'- ATCAAATCTGGGTTTGCAGAAG -3'

Sequencing Primer
(F):5'- TGTTGACAGGGAACAGCCG -3'
(R):5'- TCTGGGTTTGCAGAAGTAAAAC -3'
Posted On2019-11-26