Mutagenetix > Incidental Mutation

Incidental Mutation 'R7811:Keap1'

601171

Institutional Source

Beutler Lab

Gene Symbol

Keap1

Ensembl Gene

ENSMUSG00000003308

Gene Name

kelch-like ECH-associated protein 1

Synonyms

INrf2, ring canal protein

MMRRC Submission

045866-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.965) question?

Stock #

R7811 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

21141026-21150628 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 21148956 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 17 (L17P)

Ref Sequence

ENSEMBL: ENSMUSP00000062467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000049567] [ENSMUST00000164812] [ENSMUST00000193982] [ENSMUST00000194542] [ENSMUST00000216436]

AlphaFold

Q9Z2X8

PDB Structure

Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Structural basis for the defects of human lung cancer somatic mutations in the repression activity of Keap1 on Nrf2 [X-RAY DIFFRACTION]
Crystal structure of the Keap1 protein in complexed with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]
Crystal structure of Keap1 complexed with Prothymosin alpha [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with Sequestosome-1/p62 [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with phosphorylated p62 [X-RAY DIFFRACTION]
Crystal Structure of Keap1 in Complex with the N-terminal region of the Nrf2 transcription factor [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000049567
AA Change: L17P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000062467
Gene: ENSMUSG00000003308
AA Change: L17P

Domain	Start	End	E-Value	Type
BTB	77	179	1.33e-25	SMART
BACK	184	286	2.19e-34	SMART
Kelch	327	372	4.2e-11	SMART
Kelch	373	423	4.1e-14	SMART
Kelch	424	470	5.12e-15	SMART
Kelch	471	517	1.02e-18	SMART
Kelch	518	564	1.23e-17	SMART
Kelch	565	611	7.58e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000164812
AA Change: L17P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000131029
Gene: ENSMUSG00000003308
AA Change: L17P

Domain	Start	End	E-Value	Type
BTB	77	179	1.33e-25	SMART
BACK	184	286	2.19e-34	SMART
Kelch	327	372	4.2e-11	SMART
Kelch	373	423	4.1e-14	SMART
Kelch	424	470	5.12e-15	SMART
Kelch	471	517	1.02e-18	SMART
Kelch	518	564	1.23e-17	SMART
Kelch	565	611	7.58e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000193982
AA Change: L17P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141840
Gene: ENSMUSG00000003308
AA Change: L17P

Domain	Start	End	E-Value	Type
BTB	77	179	1.33e-25	SMART
BACK	184	286	2.19e-34	SMART
Kelch	327	372	4.2e-11	SMART
Kelch	373	423	4.1e-14	SMART
Kelch	424	470	5.12e-15	SMART
Kelch	471	517	1.02e-18	SMART
Kelch	518	564	1.23e-17	SMART
Kelch	565	611	7.58e-18	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000194542
AA Change: L17P

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000141807
Gene: ENSMUSG00000003308
AA Change: L17P

Domain	Start	End	E-Value	Type
BTB	77	179	1.33e-25	SMART
BACK	184	286	2.19e-34	SMART
Kelch	327	372	4.2e-11	SMART
Kelch	373	423	4.1e-14	SMART
Kelch	424	470	5.12e-15	SMART
Kelch	471	517	1.02e-18	SMART
Kelch	518	564	1.23e-17	SMART
Kelch	565	611	7.58e-18	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000216436
AA Change: L17P

PolyPhen 2 Score 0.034 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing KELCH-1 like domains, as well as a BTB/POZ domain. Kelch-like ECH-associated protein 1 interacts with NF-E2-related factor 2 in a redox-sensitive manner and the dissociation of the proteins in the cytoplasm is followed by transportation of NF-E2-related factor 2 to the nucleus. This interaction results in the expression of the catalytic subunit of gamma-glutamylcysteine synthetase. Two alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit scaly skin, hyperkeratosis of the esophagus and stomach mucosa, and die around 3 weeks of age, putatively due to malnutrition resulting from the abnormal alimentary epithelium. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,527,141 (GRCm39)		probably null	Het
Abca3	A	G	17: 24,616,362 (GRCm39)	T935A	probably benign	Het
Anxa7	A	T	14: 20,510,254 (GRCm39)	Y399N	probably benign	Het
Arhgef10l	G	T	4: 140,242,335 (GRCm39)	T1030K	possibly damaging	Het
Ass1	G	A	2: 31,404,753 (GRCm39)	V345I	probably benign	Het
Bms1	T	C	6: 118,380,099 (GRCm39)	D736G	probably damaging	Het
Bpifb1	T	A	2: 154,048,484 (GRCm39)		probably null	Het
Cbx4	A	C	11: 118,972,398 (GRCm39)	C326G	probably benign	Het
Ccdc188	A	G	16: 18,036,314 (GRCm39)	E94G	probably benign	Het
Cdh5	A	G	8: 104,852,235 (GRCm39)	T117A	possibly damaging	Het
Cdk11b	A	G	4: 155,724,359 (GRCm39)	T326A	unknown	Het
Clec5a	C	T	6: 40,558,867 (GRCm39)	C73Y	probably damaging	Het
Cntrl	T	C	2: 35,052,873 (GRCm39)	M1126T	probably benign	Het
Diaph3	T	C	14: 87,219,060 (GRCm39)	D455G	probably damaging	Het
Eml2	T	A	7: 18,920,047 (GRCm39)	M117K	probably benign	Het
Ern1	A	T	11: 106,325,694 (GRCm39)	V112D	unknown	Het
Eya3	T	C	4: 132,439,272 (GRCm39)	I466T	possibly damaging	Het
Fbxl6	T	C	15: 76,421,485 (GRCm39)		probably null	Het
Ffar1	A	G	7: 30,560,802 (GRCm39)	S32P	possibly damaging	Het
Fgb	T	C	3: 82,957,004 (GRCm39)	D22G	probably benign	Het
Fsip2	T	C	2: 82,828,797 (GRCm39)	Y6865H	possibly damaging	Het
Gbx1	T	C	5: 24,710,035 (GRCm39)	E270G	probably damaging	Het
Golga4	T	C	9: 118,361,643 (GRCm39)	L207P	probably damaging	Het
Hnrnpa1	T	C	15: 103,149,900 (GRCm39)	S54P	possibly damaging	Het
Htr4	A	G	18: 62,545,269 (GRCm39)	E18G	possibly damaging	Het
Ide	A	C	19: 37,307,910 (GRCm39)	L34R		Het
Ip6k3	A	T	17: 27,376,557 (GRCm39)	Y51*	probably null	Het
Lrrn2	T	C	1: 132,866,939 (GRCm39)	V668A	probably benign	Het
Lypd8	A	T	11: 58,281,064 (GRCm39)	T209S	possibly damaging	Het
Myo10	T	C	15: 25,804,610 (GRCm39)	I1635T	probably damaging	Het
Myo1e	T	A	9: 70,234,544 (GRCm39)	V299E	probably damaging	Het
Nadk	A	T	4: 155,661,332 (GRCm39)		probably benign	Het
Nalcn	A	T	14: 123,536,357 (GRCm39)	W1231R	probably damaging	Het
Odf2l	A	G	3: 144,859,148 (GRCm39)	T602A	probably benign	Het
Or13g1	T	A	7: 85,955,554 (GRCm39)	T256S	probably damaging	Het
Or2r3	T	A	6: 42,448,635 (GRCm39)	E159V	probably damaging	Het
Pde6c	T	C	19: 38,128,507 (GRCm39)	V190A	possibly damaging	Het
Ppp4r3a	C	A	12: 101,019,821 (GRCm39)	R378L	probably damaging	Het
Pus7l	A	C	15: 94,438,707 (GRCm39)	V46G	probably damaging	Het
Satb2	G	A	1: 56,884,880 (GRCm39)	S466L	probably benign	Het
Serpina6	A	G	12: 103,620,395 (GRCm39)	M118T	probably damaging	Het
Slc29a1	T	C	17: 45,897,189 (GRCm39)	R366G	probably damaging	Het
Slc6a1	T	C	6: 114,279,515 (GRCm39)	F98S	probably damaging	Het
Spg7	T	C	8: 123,824,164 (GRCm39)	I738T	possibly damaging	Het
Srcap	T	C	7: 127,141,221 (GRCm39)	V1667A	probably damaging	Het
Stxbp5	T	C	10: 9,684,248 (GRCm39)	N574S	probably benign	Het
Syne2	A	G	12: 76,030,501 (GRCm39)		probably null	Het
Tbc1d10a	T	C	11: 4,136,948 (GRCm39)	S54P	possibly damaging	Het
Trim12c	T	C	7: 103,990,469 (GRCm39)	N336S	unknown	Het
Ubap2	T	C	4: 41,211,710 (GRCm39)	S351G	probably benign	Het
Unc13c	G	T	9: 73,600,553 (GRCm39)	A1397E	possibly damaging	Het
Ush1c	G	A	7: 45,854,710 (GRCm39)	R681*	probably null	Het
Vmn2r57	A	T	7: 41,074,439 (GRCm39)	C541*	probably null	Het
Vmn2r73	T	C	7: 85,524,956 (GRCm39)	D64G	possibly damaging	Het
Vmn2r88	A	T	14: 51,656,160 (GRCm39)	T790S		Het
Zfp568	A	G	7: 29,697,295 (GRCm39)	T72A	possibly damaging	Het
Zfp950	A	T	19: 61,108,353 (GRCm39)	Y243*	probably null	Het
Zmym5	A	G	14: 57,036,434 (GRCm39)	S238P	probably damaging	Het
Zswim5	A	G	4: 116,734,673 (GRCm39)	E6G	unknown	Het

Other mutations in Keap1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
cubs	UTSW	9	21,148,849 (GRCm39)	missense	probably benign	0.07
R1917:Keap1	UTSW	9	21,145,102 (GRCm39)	missense	probably benign
R4296:Keap1	UTSW	9	21,145,282 (GRCm39)	missense	probably damaging	1.00
R4590:Keap1	UTSW	9	21,148,905 (GRCm39)	missense	probably damaging	0.97
R4723:Keap1	UTSW	9	21,142,706 (GRCm39)	missense	probably benign	0.15
R4947:Keap1	UTSW	9	21,148,849 (GRCm39)	missense	probably benign	0.07
R4952:Keap1	UTSW	9	21,148,582 (GRCm39)	missense	probably damaging	1.00
R5024:Keap1	UTSW	9	21,148,522 (GRCm39)	missense	probably damaging	1.00
R6001:Keap1	UTSW	9	21,142,135 (GRCm39)	missense	possibly damaging	0.45
R6508:Keap1	UTSW	9	21,143,010 (GRCm39)	missense	possibly damaging	0.67
R7075:Keap1	UTSW	9	21,142,552 (GRCm39)	missense	probably benign	0.30
R7184:Keap1	UTSW	9	21,145,134 (GRCm39)	missense	probably benign
R7520:Keap1	UTSW	9	21,144,787 (GRCm39)	missense	probably benign
R7531:Keap1	UTSW	9	21,148,623 (GRCm39)	missense	probably benign	0.20
R8424:Keap1	UTSW	9	21,142,086 (GRCm39)	missense	probably benign	0.00
R8976:Keap1	UTSW	9	21,142,663 (GRCm39)	missense	probably damaging	1.00
R9154:Keap1	UTSW	9	21,142,121 (GRCm39)	nonsense	probably null
R9521:Keap1	UTSW	9	21,143,136 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGGTCACGTCACAGAGTTG -3'
(R):5'- ACTTGGCTTGGCAAAATCTG -3'

Sequencing Primer
(F):5'- AGAGTTGCTGGCTCAGGC -3'
(R):5'- TGGTGGCACATACTGTAATCCCAG -3'

Posted On

2019-11-26