Incidental Mutation 'R7811:Fbxl6'
ID 628594
Institutional Source Beutler Lab
Gene Symbol Fbxl6
Ensembl Gene ENSMUSG00000022559
Gene Name F-box and leucine-rich repeat protein 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.130) question?
Stock # R7811 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 76535721-76538746 bp(-) (GRCm38)
Type of Mutation splice site (4 bp from exon)
DNA Base Change (assembly) T to C at 76537285 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000023219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]
AlphaFold Q9QXW0
Predicted Effect probably null
Transcript: ENSMUST00000023219
SMART Domains Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
low complexity region 58 77 N/A INTRINSIC
Pfam:F-box 104 154 3.1e-6 PFAM
Pfam:F-box-like 105 155 1.8e-13 PFAM
low complexity region 163 174 N/A INTRINSIC
SCOP:d1yrga_ 184 448 3e-9 SMART
Blast:LRR 211 236 2e-6 BLAST
Blast:LRR 347 373 6e-8 BLAST
Blast:LRR 375 405 7e-9 BLAST
Blast:LRR 432 456 7e-6 BLAST
Blast:LRR 464 488 1e-5 BLAST
Blast:LRR 489 520 7e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000023220
SMART Domains Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 32 43 N/A INTRINSIC
transmembrane domain 46 68 N/A INTRINSIC
transmembrane domain 81 103 N/A INTRINSIC
transmembrane domain 113 135 N/A INTRINSIC
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 201 223 N/A INTRINSIC
Pfam:DUF1011 278 376 3e-38 PFAM
transmembrane domain 409 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000230604
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T A 11: 9,577,141 probably null Het
Abca3 A G 17: 24,397,388 T935A probably benign Het
Anxa7 A T 14: 20,460,186 Y399N probably benign Het
Arhgef10l G T 4: 140,515,024 T1030K possibly damaging Het
Ass1 G A 2: 31,514,741 V345I probably benign Het
Bms1 T C 6: 118,403,138 D736G probably damaging Het
Bpifb1 T A 2: 154,206,564 probably null Het
Cbx4 A C 11: 119,081,572 C326G probably benign Het
Ccdc188 A G 16: 18,218,450 E94G probably benign Het
Cdh5 A G 8: 104,125,603 T117A possibly damaging Het
Cdk11b A G 4: 155,639,902 T326A unknown Het
Clec5a C T 6: 40,581,933 C73Y probably damaging Het
Cntrl T C 2: 35,162,861 M1126T probably benign Het
Diaph3 T C 14: 86,981,624 D455G probably damaging Het
Eml2 T A 7: 19,186,122 M117K probably benign Het
Ern1 A T 11: 106,434,868 V112D unknown Het
Eya3 T C 4: 132,711,961 I466T possibly damaging Het
Ffar1 A G 7: 30,861,377 S32P possibly damaging Het
Fgb T C 3: 83,049,697 D22G probably benign Het
Fsip2 T C 2: 82,998,453 Y6865H possibly damaging Het
Gbx1 T C 5: 24,505,037 E270G probably damaging Het
Golga4 T C 9: 118,532,575 L207P probably damaging Het
Hnrnpa1 T C 15: 103,241,473 S54P possibly damaging Het
Htr4 A G 18: 62,412,198 E18G possibly damaging Het
Ide A C 19: 37,330,511 L34R Het
Ip6k3 A T 17: 27,157,583 Y51* probably null Het
Keap1 A G 9: 21,237,660 L17P possibly damaging Het
Lrrn2 T C 1: 132,939,201 V668A probably benign Het
Lypd8 A T 11: 58,390,238 T209S possibly damaging Het
Myo10 T C 15: 25,804,524 I1635T probably damaging Het
Myo1e T A 9: 70,327,262 V299E probably damaging Het
Nadk A T 4: 155,576,875 probably benign Het
Nalcn A T 14: 123,298,945 W1231R probably damaging Het
Odf2l A G 3: 145,153,387 T602A probably benign Het
Olfr309 T A 7: 86,306,346 T256S probably damaging Het
Olfr457 T A 6: 42,471,701 E159V probably damaging Het
Pde6c T C 19: 38,140,059 V190A possibly damaging Het
Ppp4r3a C A 12: 101,053,562 R378L probably damaging Het
Pus7l A C 15: 94,540,826 V46G probably damaging Het
Satb2 G A 1: 56,845,721 S466L probably benign Het
Serpina6 A G 12: 103,654,136 M118T probably damaging Het
Slc29a1 T C 17: 45,586,263 R366G probably damaging Het
Slc6a1 T C 6: 114,302,554 F98S probably damaging Het
Spg7 T C 8: 123,097,425 I738T possibly damaging Het
Srcap T C 7: 127,542,049 V1667A probably damaging Het
Stxbp5 T C 10: 9,808,504 N574S probably benign Het
Syne2 A G 12: 75,983,727 probably null Het
Tbc1d10a T C 11: 4,186,948 S54P possibly damaging Het
Trim12c T C 7: 104,341,262 N336S unknown Het
Ubap2 T C 4: 41,211,710 S351G probably benign Het
Unc13c G T 9: 73,693,271 A1397E possibly damaging Het
Ush1c G A 7: 46,205,286 R681* probably null Het
Vmn2r57 A T 7: 41,425,015 C541* probably null Het
Vmn2r73 T C 7: 85,875,748 D64G possibly damaging Het
Vmn2r88 A T 14: 51,418,703 T790S Het
Zfp568 A G 7: 29,997,870 T72A possibly damaging Het
Zfp950 A T 19: 61,119,915 Y243* probably null Het
Zmym5 A G 14: 56,798,977 S238P probably damaging Het
Zswim5 A G 4: 116,877,476 E6G unknown Het
Other mutations in Fbxl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Fbxl6 APN 15 76535906 nonsense probably null
IGL02205:Fbxl6 APN 15 76537341 missense probably benign 0.05
R0244:Fbxl6 UTSW 15 76537191 missense probably damaging 1.00
R0449:Fbxl6 UTSW 15 76535955 missense probably damaging 1.00
R0608:Fbxl6 UTSW 15 76536753 missense probably benign 0.04
R0904:Fbxl6 UTSW 15 76537083 splice site probably null
R1477:Fbxl6 UTSW 15 76537734 missense probably benign
R1784:Fbxl6 UTSW 15 76538058 missense probably damaging 1.00
R2109:Fbxl6 UTSW 15 76536973 missense probably damaging 0.99
R3937:Fbxl6 UTSW 15 76536624 nonsense probably null
R4414:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4416:Fbxl6 UTSW 15 76537724 missense possibly damaging 0.76
R4483:Fbxl6 UTSW 15 76537929 missense probably damaging 1.00
R4835:Fbxl6 UTSW 15 76536804 missense probably damaging 1.00
R6175:Fbxl6 UTSW 15 76538433 missense probably benign
R6345:Fbxl6 UTSW 15 76535854 missense probably damaging 1.00
R6750:Fbxl6 UTSW 15 76538412 missense probably damaging 1.00
R6800:Fbxl6 UTSW 15 76538698 unclassified probably benign
R7485:Fbxl6 UTSW 15 76537913 splice site probably null
R7560:Fbxl6 UTSW 15 76538469 missense probably benign 0.06
R7726:Fbxl6 UTSW 15 76535886 missense probably damaging 1.00
R8353:Fbxl6 UTSW 15 76538478 missense probably benign 0.06
R8548:Fbxl6 UTSW 15 76537342 missense possibly damaging 0.65
X0058:Fbxl6 UTSW 15 76538476 missense possibly damaging 0.71
Predicted Primers PCR Primer
(F):5'- TCGTCTGGGAACTGTAGGTC -3'
(R):5'- GCTTGTCATGACTACCAGTGTCC -3'

Sequencing Primer
(F):5'- TAGGTCAGCCACAGTTTACG -3'
(R):5'- GACTACCAGTGTCCCTGTAGATAG -3'
Posted On 2020-05-12