Mutagenetix > Incidental Mutation

Incidental Mutation 'R7811:Fbxl6'

628594

Institutional Source

Beutler Lab

Gene Symbol

Fbxl6

Ensembl Gene

ENSMUSG00000022559

Gene Name

F-box and leucine-rich repeat protein 6

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.119) question?

Stock #

R7811 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76535721-76538746 bp(-) (GRCm38)

Type of Mutation

splice site (4 bp from exon)

DNA Base Change (assembly)

T to C at 76537285 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000023219 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023219] [ENSMUST00000023220] [ENSMUST00000230604]

AlphaFold

Q9QXW0

Predicted Effect

probably null
Transcript: ENSMUST00000023219

SMART Domains

Protein: ENSMUSP00000023219
Gene: ENSMUSG00000022559

Domain	Start	End	E-Value	Type
low complexity region	2	22	N/A	INTRINSIC
low complexity region	58	77	N/A	INTRINSIC
Pfam:F-box	104	154	3.1e-6	PFAM
Pfam:F-box-like	105	155	1.8e-13	PFAM
low complexity region	163	174	N/A	INTRINSIC
SCOP:d1yrga_	184	448	3e-9	SMART
Blast:LRR	211	236	2e-6	BLAST
Blast:LRR	347	373	6e-8	BLAST
Blast:LRR	375	405	7e-9	BLAST
Blast:LRR	432	456	7e-6	BLAST
Blast:LRR	464	488	1e-5	BLAST
Blast:LRR	489	520	7e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000023220

SMART Domains

Protein: ENSMUSP00000023220
Gene: ENSMUSG00000022560

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
low complexity region	32	43	N/A	INTRINSIC
transmembrane domain	46	68	N/A	INTRINSIC
transmembrane domain	81	103	N/A	INTRINSIC
transmembrane domain	113	135	N/A	INTRINSIC
transmembrane domain	142	164	N/A	INTRINSIC
transmembrane domain	201	223	N/A	INTRINSIC
Pfam:DUF1011	278	376	3e-38	PFAM
transmembrane domain	409	431	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000230604

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.8%
20x: 99.3%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of proteins that are characterized by an F-box motif. The encoded protein also contains leucine-rich repeats. F-box-containing proteins comprise one of the subunits of the SCF (SKP1-cullin-F-box) complex, which functions in phosphorylation-dependent ubiquitination. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 59 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca13	T	A	11: 9,577,141		probably null	Het
Abca3	A	G	17: 24,397,388	T935A	probably benign	Het
Anxa7	A	T	14: 20,460,186	Y399N	probably benign	Het
Arhgef10l	G	T	4: 140,515,024	T1030K	possibly damaging	Het
Ass1	G	A	2: 31,514,741	V345I	probably benign	Het
Bms1	T	C	6: 118,403,138	D736G	probably damaging	Het
Bpifb1	T	A	2: 154,206,564		probably null	Het
Cbx4	A	C	11: 119,081,572	C326G	probably benign	Het
Ccdc188	A	G	16: 18,218,450	E94G	probably benign	Het
Cdh5	A	G	8: 104,125,603	T117A	possibly damaging	Het
Cdk11b	A	G	4: 155,639,902	T326A	unknown	Het
Clec5a	C	T	6: 40,581,933	C73Y	probably damaging	Het
Cntrl	T	C	2: 35,162,861	M1126T	probably benign	Het
Diaph3	T	C	14: 86,981,624	D455G	probably damaging	Het
Eml2	T	A	7: 19,186,122	M117K	probably benign	Het
Ern1	A	T	11: 106,434,868	V112D	unknown	Het
Eya3	T	C	4: 132,711,961	I466T	possibly damaging	Het
Ffar1	A	G	7: 30,861,377	S32P	possibly damaging	Het
Fgb	T	C	3: 83,049,697	D22G	probably benign	Het
Fsip2	T	C	2: 82,998,453	Y6865H	possibly damaging	Het
Gbx1	T	C	5: 24,505,037	E270G	probably damaging	Het
Golga4	T	C	9: 118,532,575	L207P	probably damaging	Het
Hnrnpa1	T	C	15: 103,241,473	S54P	possibly damaging	Het
Htr4	A	G	18: 62,412,198	E18G	possibly damaging	Het
Ide	A	C	19: 37,330,511	L34R		Het
Ip6k3	A	T	17: 27,157,583	Y51*	probably null	Het
Keap1	A	G	9: 21,237,660	L17P	possibly damaging	Het
Lrrn2	T	C	1: 132,939,201	V668A	probably benign	Het
Lypd8	A	T	11: 58,390,238	T209S	possibly damaging	Het
Myo10	T	C	15: 25,804,524	I1635T	probably damaging	Het
Myo1e	T	A	9: 70,327,262	V299E	probably damaging	Het
Nadk	A	T	4: 155,576,875		probably benign	Het
Nalcn	A	T	14: 123,298,945	W1231R	probably damaging	Het
Odf2l	A	G	3: 145,153,387	T602A	probably benign	Het
Olfr309	T	A	7: 86,306,346	T256S	probably damaging	Het
Olfr457	T	A	6: 42,471,701	E159V	probably damaging	Het
Pde6c	T	C	19: 38,140,059	V190A	possibly damaging	Het
Ppp4r3a	C	A	12: 101,053,562	R378L	probably damaging	Het
Pus7l	A	C	15: 94,540,826	V46G	probably damaging	Het
Satb2	G	A	1: 56,845,721	S466L	probably benign	Het
Serpina6	A	G	12: 103,654,136	M118T	probably damaging	Het
Slc29a1	T	C	17: 45,586,263	R366G	probably damaging	Het
Slc6a1	T	C	6: 114,302,554	F98S	probably damaging	Het
Spg7	T	C	8: 123,097,425	I738T	possibly damaging	Het
Srcap	T	C	7: 127,542,049	V1667A	probably damaging	Het
Stxbp5	T	C	10: 9,808,504	N574S	probably benign	Het
Syne2	A	G	12: 75,983,727		probably null	Het
Tbc1d10a	T	C	11: 4,186,948	S54P	possibly damaging	Het
Trim12c	T	C	7: 104,341,262	N336S	unknown	Het
Ubap2	T	C	4: 41,211,710	S351G	probably benign	Het
Unc13c	G	T	9: 73,693,271	A1397E	possibly damaging	Het
Ush1c	G	A	7: 46,205,286	R681*	probably null	Het
Vmn2r57	A	T	7: 41,425,015	C541*	probably null	Het
Vmn2r73	T	C	7: 85,875,748	D64G	possibly damaging	Het
Vmn2r88	A	T	14: 51,418,703	T790S		Het
Zfp568	A	G	7: 29,997,870	T72A	possibly damaging	Het
Zfp950	A	T	19: 61,119,915	Y243*	probably null	Het
Zmym5	A	G	14: 56,798,977	S238P	probably damaging	Het
Zswim5	A	G	4: 116,877,476	E6G	unknown	Het

Other mutations in Fbxl6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02088:Fbxl6	APN	15	76535906	nonsense	probably null
IGL02205:Fbxl6	APN	15	76537341	missense	probably benign	0.05
R0244:Fbxl6	UTSW	15	76537191	missense	probably damaging	1.00
R0449:Fbxl6	UTSW	15	76535955	missense	probably damaging	1.00
R0608:Fbxl6	UTSW	15	76536753	missense	probably benign	0.04
R0904:Fbxl6	UTSW	15	76537083	splice site	probably null
R1477:Fbxl6	UTSW	15	76537734	missense	probably benign
R1784:Fbxl6	UTSW	15	76538058	missense	probably damaging	1.00
R2109:Fbxl6	UTSW	15	76536973	missense	probably damaging	0.99
R3937:Fbxl6	UTSW	15	76536624	nonsense	probably null
R4414:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4416:Fbxl6	UTSW	15	76537724	missense	possibly damaging	0.76
R4483:Fbxl6	UTSW	15	76537929	missense	probably damaging	1.00
R4835:Fbxl6	UTSW	15	76536804	missense	probably damaging	1.00
R6175:Fbxl6	UTSW	15	76538433	missense	probably benign
R6345:Fbxl6	UTSW	15	76535854	missense	probably damaging	1.00
R6750:Fbxl6	UTSW	15	76538412	missense	probably damaging	1.00
R6800:Fbxl6	UTSW	15	76538698	unclassified	probably benign
R7485:Fbxl6	UTSW	15	76537913	splice site	probably null
R7560:Fbxl6	UTSW	15	76538469	missense	probably benign	0.06
R7726:Fbxl6	UTSW	15	76535886	missense	probably damaging	1.00
R8353:Fbxl6	UTSW	15	76538478	missense	probably benign	0.06
R8548:Fbxl6	UTSW	15	76537342	missense	possibly damaging	0.65
X0058:Fbxl6	UTSW	15	76538476	missense	possibly damaging	0.71

Predicted Primers

PCR Primer
(F):5'- TCGTCTGGGAACTGTAGGTC -3'
(R):5'- GCTTGTCATGACTACCAGTGTCC -3'

Sequencing Primer
(F):5'- TAGGTCAGCCACAGTTTACG -3'
(R):5'- GACTACCAGTGTCCCTGTAGATAG -3'

Posted On

2020-05-12