Incidental Mutation 'R6508:Keap1'
ID524003
Institutional Source Beutler Lab
Gene Symbol Keap1
Ensembl Gene ENSMUSG00000003308
Gene Namekelch-like ECH-associated protein 1
SynonymsINrf2, ring canal protein
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.963) question?
Stock #R6508 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location21229730-21239361 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 21231714 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 501 (T501I)
Ref Sequence ENSEMBL: ENSMUSP00000149705 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049567] [ENSMUST00000164812] [ENSMUST00000193982] [ENSMUST00000194542] [ENSMUST00000216436]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049567
AA Change: T505I

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000062467
Gene: ENSMUSG00000003308
AA Change: T505I

DomainStartEndE-ValueType
BTB 77 179 1.33e-25 SMART
BACK 184 286 2.19e-34 SMART
Kelch 327 372 4.2e-11 SMART
Kelch 373 423 4.1e-14 SMART
Kelch 424 470 5.12e-15 SMART
Kelch 471 517 1.02e-18 SMART
Kelch 518 564 1.23e-17 SMART
Kelch 565 611 7.58e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000164812
AA Change: T505I

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000131029
Gene: ENSMUSG00000003308
AA Change: T505I

DomainStartEndE-ValueType
BTB 77 179 1.33e-25 SMART
BACK 184 286 2.19e-34 SMART
Kelch 327 372 4.2e-11 SMART
Kelch 373 423 4.1e-14 SMART
Kelch 424 470 5.12e-15 SMART
Kelch 471 517 1.02e-18 SMART
Kelch 518 564 1.23e-17 SMART
Kelch 565 611 7.58e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181222
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193429
Predicted Effect possibly damaging
Transcript: ENSMUST00000193982
AA Change: T505I

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141840
Gene: ENSMUSG00000003308
AA Change: T505I

DomainStartEndE-ValueType
BTB 77 179 1.33e-25 SMART
BACK 184 286 2.19e-34 SMART
Kelch 327 372 4.2e-11 SMART
Kelch 373 423 4.1e-14 SMART
Kelch 424 470 5.12e-15 SMART
Kelch 471 517 1.02e-18 SMART
Kelch 518 564 1.23e-17 SMART
Kelch 565 611 7.58e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000194542
AA Change: T505I

PolyPhen 2 Score 0.537 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000141807
Gene: ENSMUSG00000003308
AA Change: T505I

DomainStartEndE-ValueType
BTB 77 179 1.33e-25 SMART
BACK 184 286 2.19e-34 SMART
Kelch 327 372 4.2e-11 SMART
Kelch 373 423 4.1e-14 SMART
Kelch 424 470 5.12e-15 SMART
Kelch 471 517 1.02e-18 SMART
Kelch 518 564 1.23e-17 SMART
Kelch 565 611 7.58e-18 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000216436
AA Change: T501I

PolyPhen 2 Score 0.667 (Sensitivity: 0.86; Specificity: 0.91)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing KELCH-1 like domains, as well as a BTB/POZ domain. Kelch-like ECH-associated protein 1 interacts with NF-E2-related factor 2 in a redox-sensitive manner and the dissociation of the proteins in the cytoplasm is followed by transportation of NF-E2-related factor 2 to the nucleus. This interaction results in the expression of the catalytic subunit of gamma-glutamylcysteine synthetase. Two alternatively spliced transcript variants encoding the same isoform have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice exhibit scaly skin, hyperkeratosis of the esophagus and stomach mucosa, and die around 3 weeks of age, putatively due to malnutrition resulting from the abnormal alimentary epithelium. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Brca2 A T 5: 150,536,593 E444D possibly damaging Het
C87977 A T 4: 144,207,601 L312* probably null Het
Camkk2 G T 5: 122,746,319 N346K probably damaging Het
Car4 C A 11: 84,965,643 D252E possibly damaging Het
Chd1 A G 17: 15,738,633 K649R probably benign Het
Col12a1 A G 9: 79,649,949 Y1966H probably damaging Het
Cts6 T A 13: 61,196,407 H277L probably damaging Het
Dcc G T 18: 71,306,073 P1246Q probably damaging Het
Dlg5 G A 14: 24,138,706 T1739I probably benign Het
Eci1 T A 17: 24,437,309 N164K probably damaging Het
Entpd7 G A 19: 43,691,086 R26H probably damaging Het
Fanci A G 7: 79,443,768 K1008E probably damaging Het
Gm13124 G A 4: 144,565,020 R39* probably null Het
Htr2b T C 1: 86,102,464 T170A possibly damaging Het
Irgm2 A G 11: 58,219,501 E18G probably benign Het
Ispd C T 12: 36,426,299 A180V possibly damaging Het
Kdm1a A T 4: 136,554,310 V630E probably damaging Het
L3mbtl3 T A 10: 26,318,427 H424L unknown Het
Lrrc14b C T 13: 74,363,218 D248N possibly damaging Het
Macf1 T A 4: 123,469,742 D3364V probably damaging Het
Map3k20 G A 2: 72,441,909 G794S probably benign Het
Mcat T C 15: 83,549,251 Q34R probably benign Het
Mettl4 T C 17: 94,743,945 E148G probably damaging Het
Mgat3 T C 15: 80,212,024 S351P possibly damaging Het
Mllt1 A T 17: 56,927,054 I44N probably damaging Het
Mlxipl G T 5: 135,128,620 A337S probably benign Het
Naip1 A G 13: 100,436,465 F254L probably damaging Het
Obscn A T 11: 59,054,147 probably null Het
Olfr1494 C T 19: 13,749,354 P83S probably damaging Het
Pcdh12 G A 18: 38,281,337 R912* probably null Het
Pcdh17 A G 14: 84,447,979 N629D probably damaging Het
Pcnx T C 12: 81,912,705 I170T probably damaging Het
Pgr A G 9: 8,956,289 Y746C probably damaging Het
Pum2 T C 12: 8,748,861 Y991H probably benign Het
Rcc1l A T 5: 134,169,238 V185D probably damaging Het
Scarb1 A T 5: 125,304,325 S52T possibly damaging Het
Smc1b C T 15: 85,092,031 R825Q probably benign Het
Spata4 T C 8: 54,600,852 S18P probably benign Het
Stard13 G A 5: 151,063,289 T134I probably benign Het
Tbc1d32 C T 10: 56,224,690 C64Y probably damaging Het
Tll1 T G 8: 64,098,460 I296L probably damaging Het
Tmem229b T G 12: 78,964,906 T84P probably damaging Het
Ttn T C 2: 76,714,413 T32782A possibly damaging Het
Vmn1r73 G A 7: 11,756,704 V150I possibly damaging Het
Vmn2r80 T A 10: 79,194,456 F705L probably benign Het
Other mutations in Keap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
cubs UTSW 9 21237553 missense probably benign 0.07
R1917:Keap1 UTSW 9 21233806 missense probably benign
R4296:Keap1 UTSW 9 21233986 missense probably damaging 1.00
R4590:Keap1 UTSW 9 21237609 missense probably damaging 0.97
R4723:Keap1 UTSW 9 21231410 missense probably benign 0.15
R4947:Keap1 UTSW 9 21237553 missense probably benign 0.07
R4952:Keap1 UTSW 9 21237286 missense probably damaging 1.00
R5024:Keap1 UTSW 9 21237226 missense probably damaging 1.00
R6001:Keap1 UTSW 9 21230839 missense possibly damaging 0.45
R7075:Keap1 UTSW 9 21231256 missense probably benign 0.30
R7184:Keap1 UTSW 9 21233838 missense probably benign
R7520:Keap1 UTSW 9 21233491 missense probably benign
R7531:Keap1 UTSW 9 21237327 missense probably benign 0.20
R7811:Keap1 UTSW 9 21237660 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACTTTAGTAGCCACTGCCC -3'
(R):5'- TTTGCAGATATGAGCCAGAGC -3'

Sequencing Primer
(F):5'- TCCACCACTGGAGAAGCTG -3'
(R):5'- TATGAGCCAGAGCGGGAC -3'
Posted On2018-06-22