Incidental Mutation 'RF039:Cckbr'
ID604715
Institutional Source Beutler Lab
Gene Symbol Cckbr
Ensembl Gene ENSMUSG00000030898
Gene Namecholecystokinin B receptor
SynonymsCCK2/gastrin, CCK2R, CCKR-2, CCK-B/gastrin receptor
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #RF039 (G1)
Quality Score139.457
Status Not validated
Chromosome7
Chromosomal Location105425731-105470898 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GCA to G at 105434686 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000033189 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033189] [ENSMUST00000181339]
Predicted Effect probably null
Transcript: ENSMUST00000033189
SMART Domains Protein: ENSMUSP00000033189
Gene: ENSMUSG00000030898

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 396 4.1e-59 PFAM
low complexity region 409 434 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000181339
SMART Domains Protein: ENSMUSP00000138052
Gene: ENSMUSG00000030898

DomainStartEndE-ValueType
low complexity region 9 21 N/A INTRINSIC
low complexity region 27 38 N/A INTRINSIC
Pfam:7tm_1 71 301 3.3e-49 PFAM
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a multipass transmembrane receptor protein expressed in the central nervous system and gastrointestinal tract. Cholecystokinin and gastrin bind to the encoded protein to stimulate gastric acid secretion and mucosal growth in the gastrointestinal tract, and anxiety, pain sensation and memory in the brain. Mice lacking the encoded protein exhibit an increase in the basal gastric pH and gastrin levels in the bloodstream as well as mild hypocalcemia, secondary hyperparathyroidism and increased bone resorption. [provided by RefSeq, Apr 2015]
PHENOTYPE: Nullizygous mice show gastic mucoca defects, high gastic pH and hypergastrenemia. Homozygotes for a null allele also exhibit higher energy intake and expenditure, less susceptibility to endotoxin shock, altered pain and mechanical sensitivity, and behavioral changes to isolation and addictive drugs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acap3 GCATCCTGGGCTGCT GCATCCTGGGCTGCTTCATCCTGGGCTGCT 4: 155,905,092 probably benign Het
Ankhd1 GGCGGC GGCGGCTGCGGC 18: 36,560,918 probably benign Het
Camkv CGCTGCTGC CGC 9: 107,947,860 probably benign Het
Cd276 G A 9: 58,535,504 R223C probably damaging Het
Cdx1 CTGCTG CTGCTGATGCTG 18: 61,019,870 probably benign Het
Cul9 CCT CCTTCT 17: 46,500,854 probably benign Het
Dcdc2b GCTGC GCTGCCAGGTCTGC 4: 129,609,651 probably benign Het
Dusp9 TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG TAAAGCGGAGGCCAAAGCGGAGGCCAAAGCGGAGGCTAAAGCGGAGGCCAAAGCGGAGGCCAAAG X: 73,640,611 probably benign Het
Eml6 CTAAAAAAACAAAACA C 11: 29,752,551 probably benign Het
Eps8 C CTCAT 6: 137,517,070 probably null Het
Exd2 CACAGCCA C 12: 80,475,941 probably null Het
Gab3 TTC TTCGTC X: 75,000,004 probably benign Het
Gm10718 ATTTTCAGTTTCCTCGCCATATTCCAGGTCCTACAGTGTGCATTTCTCATTTTTCACGTTTTTCAGT ATTTTCAGT 9: 3,024,385 probably null Het
Gm21671 CTTT C 5: 25,950,859 probably benign Het
Gm8369 GTGTGT GTGTGTTTGTGT 19: 11,511,758 probably benign Het
Gm8369 GTG GTGTTTTTG 19: 11,511,782 probably benign Het
Igf1r GG GGTGATGGAGCTTG 7: 68,226,176 probably benign Het
Il2 GG GGGCTTGTTGTGTG 3: 37,125,842 probably benign Het
Kif12 GGC GGCCTCCAACCGGCCAGC 4: 63,171,425 probably benign Het
L1td1 AGGAGGAGGAGGAGGAGGAGGAGGGGGAGGAGGAG AGGAGGAGGAG 4: 98,736,789 probably benign Het
Lrch1 CGTGGTGCTGGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG CGTGGTGTTGGTGGTGTTGGTGGTGCTGGTGG 14: 74,947,549 probably benign Het
Lypd8 ACCAATCACCAAC ACCAATCACCAACTGTTCCCTCGCCTCTGTTTCCCCCCCAATCACCAAC 11: 58,390,231 probably benign Het
Mamld1 AGC AGCCGC X: 71,118,826 probably benign Het
Mamld1 CAG CAGAAG X: 71,118,840 probably benign Het
Map1a CCAGC CCAGCCCCAGCTCCAGCTCCAGCTCCAGCTACAGC 2: 121,306,304 probably benign Het
Mast4 CCTCGGGGACAAGCTGTGAGTTGGGGAAC CC 13: 102,739,241 probably benign Het
Nefh AGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC AGCTGGGGACTTGGCCTCAGCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTCACCTGGGGACTTGGCCTC 11: 4,941,007 probably benign Het
Olfr1287 G A 2: 111,449,551 G137D not run Het
Papd7 GACA G 13: 69,533,854 probably benign Het
Pdcd11 GGAGGAGA G 19: 47,113,455 probably null Het
Peg3 GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC GTGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTCCTGGCCATGGGGCTTATCATCATGGGGCTC 7: 6,709,168 probably benign Het
Pnmal1 CAACATC CAACATCTCATGATGCACCTGCTTTAACATC 7: 16,961,444 probably benign Het
Prp2 AGGCCCACAGCAGCGACCCCCTCAAGGCCCACCACCACCAGGTGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC AGGCCCACAGCCGAGACCCCCTCAAGGCCCACCACC 6: 132,600,501 probably benign Het
Prr5l GCCTC G 2: 101,797,573 probably null Het
Rassf6 TCATGGTCCTGTAGAGCAATGGGGATTC TCATGGTCCTGTAGAGCAATGGGGATTCTGCCTCACGCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,915 probably benign Het
Rassf6 ATTC ATTCTGCCTCACTCATGTTCCTGTAGAGCAATGGGGTTTC 5: 90,608,939 probably benign Het
Slc39a4 GTC GTCATCATGATCACCATGGTCCCCATGATCACTGTGCTC 15: 76,614,870 probably benign Het
Slc39a4 TC TCATCGTGATCACCATGGTCACCATGATCACTGTGGAC 15: 76,614,871 probably benign Het
Strn TTACCCC TTACCCCTGGCCGTGCTCCCTTACCCCAGTCCGTGCGCCCGTACCCC 17: 78,677,278 probably null Het
Tbc1d12 CGGAGGAGG CGG 19: 38,836,957 probably benign Het
Tfeb CAG CAGAAG 17: 47,786,095 probably benign Het
Tfeb CAG CAGTAG 17: 47,786,110 probably null Het
Thbs1 TGACCTTAG TG 2: 118,122,865 probably benign Het
Thegl GCGATCCTCCCCAGTCCCGCAAGGCCA GCGATCCTCCCCAGGCCCGCAAGGCCACCGATCCTCCCCAGTCCCGCAAGGCCA 5: 77,016,402 probably benign Het
Tmem28 CCG CCGCCGGCG X: 99,821,372 probably benign Het
Tmprss13 ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC ATCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTCAGGCCTCTCCAGCAAGGACACCTCCTCAGGCCTCTCCAACAAGGACACCTCCTCAGGCCTCTCCAGCAAGGGCACCTCCTC 9: 45,328,464 probably benign Het
Triobp CCCCAGGACTCCCTGTGCCCAACGG CCCCAGGACTCCCTGTGCCCAACGGAACAAACCCAGGACTCCCTGTGCCCAACGG 15: 78,967,036 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Ufl1 C T 4: 25,280,628 R73Q possibly damaging Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zc3h4 TGACATGCACCCTGACATGCACCCAGACATGCACCCCGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA TGACATGCACCCTGACATGCACCCCGACATGCACCCCGACATGCACCCTGACATGCA 7: 16,429,618 probably benign Het
Other mutations in Cckbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00503:Cckbr APN 7 105434242 missense probably benign 0.01
IGL01630:Cckbr APN 7 105434086 missense probably damaging 1.00
IGL01931:Cckbr APN 7 105426103 missense probably benign
IGL01955:Cckbr APN 7 105434962 missense probably damaging 0.97
IGL02219:Cckbr APN 7 105434048 missense probably damaging 1.00
IGL02820:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02858:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02878:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL02946:Cckbr APN 7 105434031 missense probably damaging 1.00
IGL03179:Cckbr APN 7 105434923 missense probably benign 0.02
FR4548:Cckbr UTSW 7 105434681 small deletion probably benign
R0380:Cckbr UTSW 7 105434991 missense probably benign 0.00
R1767:Cckbr UTSW 7 105434551 missense possibly damaging 0.56
R3890:Cckbr UTSW 7 105426169 missense probably benign 0.00
R3892:Cckbr UTSW 7 105426169 missense probably benign 0.00
R5116:Cckbr UTSW 7 105433655 missense probably damaging 1.00
R5589:Cckbr UTSW 7 105434525 missense probably damaging 0.98
R5975:Cckbr UTSW 7 105470619 missense probably benign 0.07
R6797:Cckbr UTSW 7 105434566 missense possibly damaging 0.85
R6940:Cckbr UTSW 7 105434896 missense probably benign 0.00
R7194:Cckbr UTSW 7 105435345 missense possibly damaging 0.72
R7293:Cckbr UTSW 7 105434645 missense probably benign 0.05
R7581:Cckbr UTSW 7 105433786 missense probably benign 0.05
R7793:Cckbr UTSW 7 105433591 missense probably benign 0.00
R7891:Cckbr UTSW 7 105435350 missense probably benign 0.00
R7974:Cckbr UTSW 7 105435350 missense probably benign 0.00
RF009:Cckbr UTSW 7 105434686 frame shift probably null
RF062:Cckbr UTSW 7 105434687 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CAGGTCCGTGCTTCTGCTAATAC -3'
(R):5'- AGCAGCCATCACTGTCTTCC -3'

Sequencing Primer
(F):5'- GTGCTTCTGCTAATACTGCTG -3'
(R):5'- AGTCAGGCTGGTCACATGC -3'
Posted On2019-12-04