Incidental Mutation 'RF053:Mamld1'
ID605195
Institutional Source Beutler Lab
Gene Symbol Mamld1
Ensembl Gene ENSMUSG00000059401
Gene Namemastermind-like domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF053 (G1)
Quality Score176.468
Status Not validated
ChromosomeX
Chromosomal Location71050256-71156056 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) CA to CAGAA at 71118852 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082088] [ENSMUST00000114629]
Predicted Effect probably benign
Transcript: ENSMUST00000082088
SMART Domains Protein: ENSMUSP00000080737
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 3.74e-7 PROSPERO
internal_repeat_1 418 466 3.74e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114629
SMART Domains Protein: ENSMUSP00000110276
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 2.31e-7 PROSPERO
internal_repeat_1 418 466 2.31e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice exhibit normal male genitalia and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TGGCTGCTG TGGCTGCTGGGGCTGCTG 1: 82,913,573 probably benign Het
Abra TGGC T 15: 41,866,299 probably benign Het
Blm CTCCTCCTCCTC CTCCTCCTCCTCATCCTCCTCCTC 7: 80,512,921 probably benign Het
Bmp5 TGAGGAG T 9: 75,776,374 probably benign Het
Cngb1 GGCTCTGGCTCTGGCTCTGGCTCTG GG 8: 95,303,648 probably null Het
Cyb5r4 GGATGTGACAGACACACTGCCCAG GGATGTGACAGACACACTGCCCAGCGATGTGACAGACACACTGCCCAG 9: 87,040,422 probably benign Het
Ehbp1l1 TCACACCACC T 19: 5,716,002 probably benign Het
Kdm3a TTTTT TTTTTT 6: 71,632,049 probably benign Het
Krtap28-10 CAGCCACCACAGC CAGCCACCACAGCCAAAGCCACCACAGC 1: 83,042,278 probably benign Het
Map1a CTCCAGCTCCAGCTCCAGCTCCAGCTCCA CTCCAGCTCCAGCTCCAGCTCCAGCTCCAGATCCAGCTCCAGCTCCAGCTCCAGCTCCA 2: 121,306,290 probably benign Het
Med12l CAG CAGAAG 3: 59,275,993 probably benign Het
Nefh GACTTGGCCTCACCT GACTTGGCCTCACCTCACCACTTGGCCTCACCT 11: 4,941,014 probably null Het
Rap1gds1 TCATTTATTATGACCATAC TC 3: 138,941,657 probably null Het
Tcof1 C CAGA 18: 60,835,747 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,114 probably benign Het
Trappc9 TGCT TGCTGCTGCTGCTGCGGCT 15: 72,801,328 probably benign Het
Usp2 C CTCATGTGACCTGTTCTTCACTTAA 9: 44,089,129 probably benign Het
Zfp598 CCCACCACCACAACCACCACCACCACCACCAC CCCACCACCACCACCACAACCACCACCACCACCACCAC 17: 24,680,761 probably benign Het
Zfp69 GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGATGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC GTGCCAGGGGTCTCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTCGCTTCATCATGGGATCCTGTTGCAGTGGTGCCAGGGGTCGCTCCATCATGGGATCCTGCTGCAGGGGTGCCAGGGGTC 4: 120,947,347 probably benign Het
Znrd1as CACCAC CACCACCACCACCACCACCTCTACCAC 17: 36,965,066 probably benign Het
Other mutations in Mamld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02484:Mamld1 APN X 71118652 missense possibly damaging 0.93
FR4340:Mamld1 UTSW X 71118846 small insertion probably benign
FR4737:Mamld1 UTSW X 71118835 small insertion probably benign
FR4737:Mamld1 UTSW X 71118839 small insertion probably benign
FR4976:Mamld1 UTSW X 71118812 small insertion probably benign
FR4976:Mamld1 UTSW X 71118818 small insertion probably benign
R2133:Mamld1 UTSW X 71119392 missense probably benign 0.00
R2277:Mamld1 UTSW X 71118815 small deletion probably benign
RF003:Mamld1 UTSW X 71118820 small insertion probably benign
RF004:Mamld1 UTSW X 71118831 nonsense probably null
RF014:Mamld1 UTSW X 71118845 small insertion probably benign
RF015:Mamld1 UTSW X 71118820 small insertion probably benign
RF015:Mamld1 UTSW X 71118841 small insertion probably benign
RF018:Mamld1 UTSW X 71118849 small insertion probably benign
RF022:Mamld1 UTSW X 71118820 small insertion probably benign
RF025:Mamld1 UTSW X 71118826 small insertion probably benign
RF030:Mamld1 UTSW X 71118828 nonsense probably null
RF033:Mamld1 UTSW X 71118833 small insertion probably benign
RF034:Mamld1 UTSW X 71118835 small insertion probably benign
RF035:Mamld1 UTSW X 71118812 small insertion probably benign
RF035:Mamld1 UTSW X 71118838 small insertion probably benign
RF035:Mamld1 UTSW X 71118850 small insertion probably benign
RF036:Mamld1 UTSW X 71118828 small insertion probably benign
RF036:Mamld1 UTSW X 71118835 small insertion probably benign
RF036:Mamld1 UTSW X 71118840 small insertion probably benign
RF038:Mamld1 UTSW X 71118846 small insertion probably benign
RF039:Mamld1 UTSW X 71118826 small insertion probably benign
RF039:Mamld1 UTSW X 71118840 small insertion probably benign
RF040:Mamld1 UTSW X 71118814 small insertion probably benign
RF041:Mamld1 UTSW X 71118826 small insertion probably benign
RF041:Mamld1 UTSW X 71118829 small insertion probably benign
RF042:Mamld1 UTSW X 71118812 small insertion probably benign
RF042:Mamld1 UTSW X 71118853 small insertion probably benign
RF043:Mamld1 UTSW X 71118835 small insertion probably benign
RF047:Mamld1 UTSW X 71118839 small insertion probably benign
RF048:Mamld1 UTSW X 71118852 nonsense probably null
RF049:Mamld1 UTSW X 71118833 small insertion probably benign
RF049:Mamld1 UTSW X 71118845 small insertion probably benign
RF055:Mamld1 UTSW X 71118837 small insertion probably benign
RF059:Mamld1 UTSW X 71118832 small insertion probably benign
RF060:Mamld1 UTSW X 71118831 nonsense probably null
RF060:Mamld1 UTSW X 71118832 small insertion probably benign
RF061:Mamld1 UTSW X 71118850 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GATATCTGCTCTGCCTACCAG -3'
(R):5'- AGACATGGAGGCCATCTTCTG -3'

Sequencing Primer
(F):5'- GCTCTGCCTACCAGCACCC -3'
(R):5'- TGGGGGCTTGGCTCAGAAAC -3'
Posted On2019-12-04