Incidental Mutation 'RF035:Mamld1'
ID604559
Institutional Source Beutler Lab
Gene Symbol Mamld1
Ensembl Gene ENSMUSG00000059401
Gene Namemastermind-like domain containing 1
Synonyms
Accession Numbers
Is this an essential gene? Not available question?
Stock #RF035 (G1)
Quality Score135.467
Status Not validated
ChromosomeX
Chromosomal Location71050256-71156056 bp(+) (GRCm38)
Type of Mutationsmall insertion (1 aa in frame mutation)
DNA Base Change (assembly) GCAACA to GCAACAACA at 71118812 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000110276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082088] [ENSMUST00000114629]
Predicted Effect probably benign
Transcript: ENSMUST00000082088
SMART Domains Protein: ENSMUSP00000080737
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 3.74e-7 PROSPERO
internal_repeat_1 418 466 3.74e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114629
SMART Domains Protein: ENSMUSP00000110276
Gene: ENSMUSG00000059401

DomainStartEndE-ValueType
low complexity region 153 163 N/A INTRINSIC
low complexity region 241 257 N/A INTRINSIC
low complexity region 310 341 N/A INTRINSIC
low complexity region 347 362 N/A INTRINSIC
internal_repeat_1 363 414 2.31e-7 PROSPERO
internal_repeat_1 418 466 2.31e-7 PROSPERO
low complexity region 571 588 N/A INTRINSIC
low complexity region 592 637 N/A INTRINSIC
low complexity region 643 658 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.4%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Male mice exhibit normal male genitalia and fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik TAT TATTATTATTATTATGAT 3: 37,050,758 probably benign Het
A030005L19Rik T TTTGGCTGCC 1: 82,913,589 probably benign Het
Acap3 TGCATCCTGGGCTGC TGCATCCTGGGCTGCCGCATCCTGGGCTGC 4: 155,905,091 probably benign Het
AI837181 G GGCT 19: 5,425,238 probably benign Het
Amfr GCC GCCGGCGCGAGCTCC 8: 94,012,292 probably benign Het
Amot GGAGCAGCAA G X: 145,450,988 probably benign Het
Cacna1f GAG GAGTAG X: 7,620,054 probably null Het
Calhm1 CTGTGGCTGTGGCTGTGGCTGTGG CTGTGGCTGTGGTTGTGGCTGTGGCTGTGGCTGTGG 19: 47,141,253 probably benign Het
Chga G GCAT 12: 102,561,427 probably benign Het
E4f1 CGC CGCTGC 17: 24,455,190 probably benign Het
E4f1 CCG CCGGCG 17: 24,455,195 probably benign Het
Eps8 C CTCAG 6: 137,517,070 probably null Het
Exd2 GCAGCCACAGCAGCCGCAGCAGCCGCAGCCACAGCCACAGCCACAGCCACAGCCACAGC GCAGCCACAGC 12: 80,475,900 probably benign Het
Exd2 CAGCCAGAGC CAGC 12: 80,475,955 probably benign Het
Gm10447 AAAAAAAAAGAAAAA AAAAAA 11: 53,456,338 probably benign Het
Gm10521 CTCTCTCTCT CTCTCTCTCTCTCT 1: 171,896,293 probably null Het
Gm8369 TGTG TGTGCGAGTG 19: 11,511,773 probably benign Het
Gucy1b2 CACACACACACACACACTTAC CAC 14: 62,408,641 probably benign Het
Ier5l TTGCTGCTGCTGCTGCTG TTGCTGCTGCTGCTG 2: 30,473,820 probably benign Het
Kmt2b TTCTCCT TTCTCCTTCTCCT 7: 30,586,357 probably benign Het
Krtap28-10 CAG CAGCCAAAG 1: 83,042,146 probably benign Het
Krtap28-10 CCACCACAGC CCACCACAGCCACAGTCACCACAGC 1: 83,042,281 probably benign Het
Lmx1b TCCATCTTGATGCCGTCCAACATCTTGATGCCGTCCA TACATCTTGATGCCGTCCA 2: 33,640,489 probably null Het
Manbal CGATAGAAT C 2: 157,396,012 probably null Het
Map1a GCTCCAGCTCCAGCTCCA GCTCCAGCTCCAGCTCCAGCTCCAGCTCCATCTCCAGCTCCAGCTCCA 2: 121,306,301 probably benign Het
Mcph1 CTCT CTCTTCT 8: 18,652,525 probably benign Het
Nefh CCTCACCTGGGGACTTGG CCTCACCTGGGGACTTGGGCTCACCTGGGGACTTGG 11: 4,941,039 probably benign Het
Nusap1 GATACACGTTAGCAGTGAGGAGCAAGCTGA GATACACGTTAGCAGTGAGGAGCAAGCTGATATACACGTTAGCAGTGAGGAGCAAGCTGA 2: 119,627,579 probably benign Het
Olfr331 TGGAGGTGGATTGG TG 11: 58,502,382 probably benign Het
P4ha2 CCAGGTG C 11: 54,110,235 probably benign Het
Pdik1l CCACCA CCACCAACACCA 4: 134,279,510 probably benign Het
Rassf6 GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC GCCTCACTCATGGTCCTGTAGAGCAATGGGGATTCTTCCTCACTCATGGTCCTGTAGAGCAATGGGGATTC 5: 90,608,908 probably benign Het
Rfx4 TCTCTCTCTCTCTCT TCTCTCTCTCTCTCTCGCTCTCTCTCTCTCT 10: 84,858,480 probably benign Het
Rgs22 GCTAAAAAAAAAAAAAAAAA G 15: 36,010,835 probably benign Het
Rpgrip1 AGG AGGGGG 14: 52,149,393 probably benign Het
Slc39a4 TGTGGTC TGTGGTCATCATGATCACCATGGTCACCATGAGCACGGTGGTC 15: 76,614,866 probably benign Het
Srpk2 ATCCT AT 5: 23,525,575 probably benign Het
Strn AGTC AGTCCGTGCTCCCTTACCCCAGTCCGTGCTCCCTTACCCCTGTC 17: 78,677,285 probably null Het
Tcof1 AAGAT AAGATTGGCCCTTTCCCAGAGATGCCCTTGGCTGCTGAGAT 18: 60,833,553 probably benign Het
Tfeb AGC AGCCGC 17: 47,786,111 probably benign Het
Tmem59 T TGTTTGTTG 4: 107,190,532 probably benign Het
Trav6d-5 ATTTTT ATTTTTTTTTT 14: 52,795,334 probably benign Het
Triobp CAGGACTCCCTGTGCCCAACGG CAGGACTCCCTGTGCCCAACGGAACAACCCAAGGACTCCCTGTGCCCAACGG 15: 78,967,039 probably benign Het
Tsen2 GGA GGATGA 6: 115,560,067 probably benign Het
Ttf2 TTCT TTCTTCT 3: 100,963,157 probably benign Het
Vat1l C T 8: 114,289,329 L320F probably damaging Het
Xirp2 TT TTTAT 2: 67,525,544 probably benign Het
Yipf3 AGAGGA AGA 17: 46,248,972 probably benign Het
Zfp933 TT TTTGCGT 4: 147,825,731 probably null Het
Znrd1as CACCAC CACCACCCCCACCACCACCACAACCAC 17: 36,965,066 probably benign Het
Other mutations in Mamld1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02484:Mamld1 APN X 71118652 missense possibly damaging 0.93
FR4340:Mamld1 UTSW X 71118846 small insertion probably benign
FR4737:Mamld1 UTSW X 71118835 small insertion probably benign
FR4737:Mamld1 UTSW X 71118839 small insertion probably benign
FR4976:Mamld1 UTSW X 71118812 small insertion probably benign
FR4976:Mamld1 UTSW X 71118818 small insertion probably benign
R2133:Mamld1 UTSW X 71119392 missense probably benign 0.00
R2277:Mamld1 UTSW X 71118815 small deletion probably benign
RF003:Mamld1 UTSW X 71118820 small insertion probably benign
RF004:Mamld1 UTSW X 71118831 nonsense probably null
RF014:Mamld1 UTSW X 71118845 small insertion probably benign
RF015:Mamld1 UTSW X 71118820 small insertion probably benign
RF015:Mamld1 UTSW X 71118841 small insertion probably benign
RF018:Mamld1 UTSW X 71118849 small insertion probably benign
RF022:Mamld1 UTSW X 71118820 small insertion probably benign
RF025:Mamld1 UTSW X 71118826 small insertion probably benign
RF030:Mamld1 UTSW X 71118828 nonsense probably null
RF033:Mamld1 UTSW X 71118833 small insertion probably benign
RF034:Mamld1 UTSW X 71118835 small insertion probably benign
RF035:Mamld1 UTSW X 71118838 small insertion probably benign
RF035:Mamld1 UTSW X 71118850 small insertion probably benign
RF036:Mamld1 UTSW X 71118828 small insertion probably benign
RF036:Mamld1 UTSW X 71118835 small insertion probably benign
RF036:Mamld1 UTSW X 71118840 small insertion probably benign
RF038:Mamld1 UTSW X 71118846 small insertion probably benign
RF039:Mamld1 UTSW X 71118826 small insertion probably benign
RF039:Mamld1 UTSW X 71118840 small insertion probably benign
RF040:Mamld1 UTSW X 71118814 small insertion probably benign
RF041:Mamld1 UTSW X 71118826 small insertion probably benign
RF041:Mamld1 UTSW X 71118829 small insertion probably benign
RF042:Mamld1 UTSW X 71118812 small insertion probably benign
RF042:Mamld1 UTSW X 71118853 small insertion probably benign
RF043:Mamld1 UTSW X 71118835 small insertion probably benign
RF047:Mamld1 UTSW X 71118839 small insertion probably benign
RF048:Mamld1 UTSW X 71118852 nonsense probably null
RF049:Mamld1 UTSW X 71118833 small insertion probably benign
RF049:Mamld1 UTSW X 71118845 small insertion probably benign
RF053:Mamld1 UTSW X 71118852 small insertion probably benign
RF055:Mamld1 UTSW X 71118837 small insertion probably benign
RF059:Mamld1 UTSW X 71118832 small insertion probably benign
RF060:Mamld1 UTSW X 71118831 nonsense probably null
RF060:Mamld1 UTSW X 71118832 small insertion probably benign
RF061:Mamld1 UTSW X 71118850 small insertion probably benign
Predicted Primers PCR Primer
(F):5'- GAGCTCCATTCTTGCCAATCTG -3'
(R):5'- TGTTGCTGAAGGTAAAGGGC -3'

Sequencing Primer
(F):5'- GGTGTCCTCTAGTGTCAAAAGCC -3'
(R):5'- AAAGGGCTCAGGTGCTTC -3'
Posted On2019-12-04