Incidental Mutation 'RF060:Spaca1'
ID 605372
Institutional Source Beutler Lab
Gene Symbol Spaca1
Ensembl Gene ENSMUSG00000028264
Gene Name sperm acrosome associated 1
Synonyms 1700124L11Rik, 4930540L03Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # RF060 (G1)
Quality Score 217.554
Status Not validated
Chromosome 4
Chromosomal Location 34024874-34050191 bp(-) (GRCm38)
Type of Mutation small insertion (2 aa in frame mutation)
DNA Base Change (assembly) CTCGCT to CTCGCTGTCGCT at 34049841 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000081785 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029927] [ENSMUST00000084734]
AlphaFold Q9DA48
Predicted Effect probably benign
Transcript: ENSMUST00000029927
SMART Domains Protein: ENSMUSP00000029927
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084734
SMART Domains Protein: ENSMUSP00000081785
Gene: ENSMUSG00000028264

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
low complexity region 46 79 N/A INTRINSIC
transmembrane domain 228 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.8%
  • 3x: 99.7%
  • 10x: 99.3%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The correlation of anti-sperm antibodies with cases of unexplained infertility implicates a role for these antibodies in blocking fertilization. Improved diagnosis and treatment of immunologic infertility, as well as identification of proteins for targeted contraception, are dependent on the identification and characterization of relevant sperm antigens. The protein expressed by this gene is recognized by anti-sperm antibodies from infertile males. Furthermore, antibodies generated against the recombinant protein block in vitro fertilization. This protein localizes to the acrosomal membrane of spermatids and mature spermatozoa where it is thought to play a role in acrosomal morphogenesis and in sperm-egg binding and fusion, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null male mice are infertile and display globozoospermia and asthenozoospermia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A030005L19Rik TTGCTGTGGCTGTGGAGGTTGTGGCGGCTGTGGCTGTGG TGGCTGTGGCTGTGG 1: 82,913,396 probably benign Het
A030005L19Rik CTGTGGCTG CTGTGGCTGATGTGGCTG 1: 82,913,579 probably null Het
A030005L19Rik GCTG GCTGTGGCTTCTG 1: 82,913,587 probably benign Het
Ankhd1 G GTGGCGC 18: 36,560,922 probably benign Het
Cacna1f GAG GAGCAG X: 7,620,060 probably benign Het
Cd109 ATTTATTTAT ATTTATTTATTTCTTTATTTAT 9: 78,712,525 probably benign Het
Chd4 CC CCACTGGC 6: 125,122,145 probably benign Het
Chga GCA GCATCA 12: 102,561,424 probably benign Het
Cyb5r4 ACTGCCCAGGGATGTGACAGACACACTGCCCAGGGA ACTGCCCAGGGATCTGACAGACACGCTGCCCAGGGATGTGACAGACACACTGCCCAGGGA 9: 87,040,413 probably benign Het
Dnmt1 CGTT CGTTGTGGGGGAGGAGCACAGTTCCTACCTAGTT 9: 20,910,142 probably null Het
Fam171b GC GCCGCAAC 2: 83,812,877 probably benign Het
Fam71e1 GTCTGAGGGAGGA GTCTGAGGGAGGAAGGCTGGATCCTGGATACCTGGTTCTGAGGGAGGA 7: 44,500,525 probably null Het
Fam71e1 GAGGA GAGGAAGGCTGGATCCTGGATACCTGGGTCTGAGGTAGGA 7: 44,500,533 probably null Het
Fkbp1a GCCGCCGCCA G 2: 151,542,699 probably null Het
Gab3 TTC TTCCTC X: 75,000,013 probably benign Het
Hsdl2 AAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC AAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGCTGCAGGAGAAGCCACAGCTGCAGGAGCAGCCACAGC 4: 59,610,608 probably benign Het
Klra10 TGTAGT TGT 6: 130,275,821 probably benign Het
L1td1 GAGGAGGAGGAGGAGGAGGGGGAGGAGGAGAAGGAGGA GAGGAGGA 4: 98,736,794 probably benign Het
Mamld1 CAG CAGTAG X: 71,118,831 probably null Het
Mamld1 AGC AGCCGC X: 71,118,832 probably benign Het
Map1a A AGCTCCAGCTCCAGCTCCAGCTCCAGCTCCC 2: 121,306,318 probably benign Het
Nefh GACTTGGCC GACTTGGCCCCACCTGGGTACTTGGCC 11: 4,941,050 probably benign Het
Nefh CT CTGGGCTTCACCTGGGGATT 11: 4,941,052 probably benign Het
Pdk1 CTGGCCT C 2: 71,873,445 probably benign Het
Pou3f1 GC GCGGCGCC 4: 124,657,809 probably benign Het
Rfx4 T TCTCTCTCTCTCTCTCC 10: 84,858,494 probably benign Het
St3gal5 G GCACTC 6: 72,097,852 probably null Het
Stat1 G T 1: 52,152,260 E591D probably benign Het
Tcof1 CAG CAGTAG 18: 60,835,744 probably benign Het
Tcof1 C CAGT 18: 60,835,747 probably benign Het
Tfeb GCA GCACCA 17: 47,786,106 probably benign Het
Thegl CAG CAGCGATCCTCCCCAGTCCCGCAAGGCAAG 5: 77,016,427 probably benign Het
Tmem59 TTTGTTT TTTGTTTGCTTGTTT 4: 107,190,526 probably benign Het
Zfhx3 G GAAACAGCAA 8: 108,956,088 probably benign Het
Other mutations in Spaca1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Spaca1 APN 4 34029077 missense probably damaging 0.99
IGL01871:Spaca1 APN 4 34040894 missense probably damaging 0.98
F5770:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
FR4342:Spaca1 UTSW 4 34049838 small insertion probably benign
FR4548:Spaca1 UTSW 4 34049856 small insertion probably benign
FR4737:Spaca1 UTSW 4 34049836 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049844 small insertion probably benign
FR4976:Spaca1 UTSW 4 34049849 small insertion probably benign
R0377:Spaca1 UTSW 4 34044267 splice site probably null
R1861:Spaca1 UTSW 4 34044206 missense probably damaging 0.99
R3105:Spaca1 UTSW 4 34028468 missense probably damaging 1.00
R4930:Spaca1 UTSW 4 34044236 missense possibly damaging 0.65
R5030:Spaca1 UTSW 4 34039247 missense possibly damaging 0.65
R5137:Spaca1 UTSW 4 34029095 missense probably damaging 1.00
R5264:Spaca1 UTSW 4 34049863 missense possibly damaging 0.53
R6158:Spaca1 UTSW 4 34029176 missense probably damaging 0.99
R6824:Spaca1 UTSW 4 34049869 missense probably benign 0.00
R8039:Spaca1 UTSW 4 34044207 missense probably damaging 0.99
R8094:Spaca1 UTSW 4 34049837 missense possibly damaging 0.55
R8134:Spaca1 UTSW 4 34042157 splice site probably null
R9120:Spaca1 UTSW 4 34029168 missense probably damaging 0.97
RF006:Spaca1 UTSW 4 34049853 small insertion probably benign
RF017:Spaca1 UTSW 4 34049853 small insertion probably benign
RF032:Spaca1 UTSW 4 34049854 small insertion probably benign
RF043:Spaca1 UTSW 4 34049846 small insertion probably benign
RF044:Spaca1 UTSW 4 34049846 small insertion probably benign
RF044:Spaca1 UTSW 4 34049854 small insertion probably benign
V7580:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7581:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7582:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
V7583:Spaca1 UTSW 4 34039311 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCAGAAAACTCTACAGAAGATGGC -3'
(R):5'- ACTGTTCGAAGCAGCCTCTC -3'

Sequencing Primer
(F):5'- CTACAAAAGGATGGGCTTC -3'
(R):5'- GAAGCAGCCTCTCCTCCAG -3'
Posted On 2019-12-04