Incidental Mutation 'R7429:Lrrfip2'
ID605509
Institutional Source Beutler Lab
Gene Symbol Lrrfip2
Ensembl Gene ENSMUSG00000032497
Gene Nameleucine rich repeat (in FLII) interacting protein 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R7429 (G1)
Quality Score126.008
Status Validated
Chromosome9
Chromosomal Location111117592-111225668 bp(+) (GRCm38)
Type of Mutationsplice site (2239 bp from exon)
DNA Base Change (assembly) T to G at 111185126 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151145 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035078] [ENSMUST00000098340] [ENSMUST00000196703] [ENSMUST00000196981] [ENSMUST00000197241] [ENSMUST00000197256] [ENSMUST00000198986] [ENSMUST00000200094] [ENSMUST00000216430] [ENSMUST00000217117] [ENSMUST00000217341]
Predicted Effect probably benign
Transcript: ENSMUST00000035078
SMART Domains Protein: ENSMUSP00000035078
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 340 2.5e-106 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000098340
SMART Domains Protein: ENSMUSP00000095944
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 326 2.7e-122 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000196703
Predicted Effect probably benign
Transcript: ENSMUST00000196981
SMART Domains Protein: ENSMUSP00000142851
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 350 4.5e-113 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197241
SMART Domains Protein: ENSMUSP00000142816
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 341 1.3e-119 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197256
SMART Domains Protein: ENSMUSP00000143322
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 363 2.9e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000198986
SMART Domains Protein: ENSMUSP00000143756
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 10 174 1.9e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200094
SMART Domains Protein: ENSMUSP00000142471
Gene: ENSMUSG00000032497

DomainStartEndE-ValueType
Pfam:DUF2051 31 174 4.9e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216430
Predicted Effect probably null
Transcript: ENSMUST00000217117
Predicted Effect probably benign
Transcript: ENSMUST00000217341
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.2%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4933407L21Rik T C 1: 85,931,307 C60R unknown Het
A430033K04Rik A G 5: 138,636,183 D20G possibly damaging Het
Abca9 CA C 11: 110,127,426 probably null Het
Ankle2 C T 5: 110,234,518 T120I possibly damaging Het
Ap2b1 C T 11: 83,367,998 T765I probably benign Het
Atp8b4 A T 2: 126,403,371 V286E possibly damaging Het
Brms1l T C 12: 55,845,299 L126P probably damaging Het
Btbd7 T C 12: 102,837,780 T334A probably damaging Het
Cdh18 T C 15: 23,366,856 V216A possibly damaging Het
Chka A G 19: 3,892,787 Y415C probably damaging Het
Cnih1 C T 14: 46,780,222 V52I possibly damaging Het
Cox4i1 T A 8: 120,674,031 M145K probably damaging Het
Cubn G T 2: 13,322,993 R2674S possibly damaging Het
Cyfip1 A G 7: 55,900,593 E692G probably damaging Het
Dido1 G A 2: 180,689,526 T43M possibly damaging Het
Edc4 T C 8: 105,891,584 S1245P probably damaging Het
Enpp1 G T 10: 24,711,950 H14Q probably benign Het
Etaa1 C T 11: 17,940,281 R860Q probably damaging Het
Fam181b G A 7: 93,080,195 V59M probably benign Het
Fam184b G A 5: 45,540,888 T655I probably benign Het
Fcgr3 A G 1: 171,057,873 M61T probably benign Het
Fign T C 2: 63,979,060 D622G probably damaging Het
Frmd3 A G 4: 74,145,105 D223G probably damaging Het
Galnt4 A G 10: 99,109,748 H445R probably damaging Het
Gm13124 T A 4: 144,565,056 I27F probably benign Het
Gm44501 A G 17: 40,576,626 T12A probably null Het
Hnrnpll T A 17: 80,049,847 I247F probably damaging Het
Hs3st4 T C 7: 124,397,382 F424L probably damaging Het
Ifi206 A T 1: 173,480,591 V613E Het
Insig1 T C 5: 28,075,079 F223S probably damaging Het
Iqgap1 C T 7: 80,751,440 E500K probably benign Het
Itgav G A 2: 83,794,258 V731M probably damaging Het
Mark4 C A 7: 19,426,167 G723C probably damaging Het
Marveld3 A G 8: 109,948,468 S239P possibly damaging Het
Mast3 A C 8: 70,780,303 C1122G probably damaging Het
Ms4a4d A G 19: 11,557,933 I198M probably benign Het
Mup14 C T 4: 61,303,448 G35E probably damaging Het
Myo1a T A 10: 127,706,847 V118E probably damaging Het
Nfatc3 A G 8: 106,108,403 T794A probably benign Het
Olfr406 T A 11: 74,269,753 D121E probably damaging Het
Olfr577 A T 7: 102,973,762 S77T probably damaging Het
Olfr828 T C 9: 18,815,354 *313W probably null Het
Pde6c T A 19: 38,141,439 Y266N probably damaging Het
Pde9a T C 17: 31,470,706 L435P probably damaging Het
Pgm2 T A 4: 99,955,995 M1K probably null Het
Plcb4 T C 2: 135,968,322 Y626H probably damaging Het
Rnf10 T C 5: 115,248,680 N517D probably damaging Het
Rpap3 A T 15: 97,688,150 L320Q possibly damaging Het
Rptor T C 11: 119,846,828 W576R probably damaging Het
Scarb2 T C 5: 92,485,234 I80V probably benign Het
Serpinc1 A G 1: 160,995,441 T251A probably benign Het
Sgk3 A G 1: 9,872,258 D85G probably benign Het
Sipa1l3 T C 7: 29,387,206 D653G probably benign Het
Slc2a1 A G 4: 119,136,313 Y449C probably damaging Het
Snx13 T C 12: 35,133,358 V760A possibly damaging Het
Snx7 T C 3: 117,837,212 N249S probably benign Het
Soat2 C A 15: 102,154,300 H124Q probably damaging Het
Sugt1 T A 14: 79,619,801 probably null Het
Syne2 C T 12: 75,933,996 T1509M probably damaging Het
Syne2 T A 12: 76,040,410 L214* probably null Het
Taok2 T C 7: 126,870,677 Q993R possibly damaging Het
Tmem161b A G 13: 84,282,747 probably null Het
Tspan17 G A 13: 54,795,972 E213K probably benign Het
Ttc6 T A 12: 57,658,102 I631N probably benign Het
Ttn T A 2: 76,810,939 L13574F probably damaging Het
U2af1l4 A G 7: 30,563,390 E12G probably benign Het
Usp39 T C 6: 72,342,917 Y106C probably damaging Het
Vmn1r185 A C 7: 26,611,178 F301V probably benign Het
Zbp1 T A 2: 173,213,818 K184N unknown Het
Zfp438 A G 18: 5,214,139 V273A probably benign Het
Zswim5 A G 4: 116,975,857 T596A possibly damaging Het
Other mutations in Lrrfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01141:Lrrfip2 APN 9 111219715 missense probably damaging 1.00
IGL01408:Lrrfip2 APN 9 111214216 missense probably benign 0.11
IGL01462:Lrrfip2 APN 9 111205849 critical splice donor site probably null
IGL01845:Lrrfip2 APN 9 111199660 splice site probably benign
IGL02218:Lrrfip2 APN 9 111219725 missense probably benign
IGL02986:Lrrfip2 APN 9 111161393 splice site probably null
R0091:Lrrfip2 UTSW 9 111214243 missense probably damaging 1.00
R1101:Lrrfip2 UTSW 9 111190225 missense probably damaging 1.00
R1722:Lrrfip2 UTSW 9 111199761 missense probably damaging 1.00
R2334:Lrrfip2 UTSW 9 111219725 missense probably benign
R2336:Lrrfip2 UTSW 9 111222215 missense probably damaging 1.00
R3103:Lrrfip2 UTSW 9 111222210 missense probably damaging 1.00
R4357:Lrrfip2 UTSW 9 111199687 missense probably damaging 1.00
R5010:Lrrfip2 UTSW 9 111223972 missense possibly damaging 0.79
R5072:Lrrfip2 UTSW 9 111199804 missense probably damaging 1.00
R6026:Lrrfip2 UTSW 9 111214171 missense probably damaging 1.00
R6307:Lrrfip2 UTSW 9 111223953 missense probably damaging 1.00
R6870:Lrrfip2 UTSW 9 111216119 intron probably benign
R7099:Lrrfip2 UTSW 9 111173108 missense probably benign 0.04
R7312:Lrrfip2 UTSW 9 111177457 splice site probably null
R7847:Lrrfip2 UTSW 9 111213880 missense probably damaging 1.00
R7866:Lrrfip2 UTSW 9 111193081 missense possibly damaging 0.95
R7912:Lrrfip2 UTSW 9 111205768 missense probably damaging 1.00
Z1176:Lrrfip2 UTSW 9 111161340 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAAGACGCTTCTGGCTCAC -3'
(R):5'- GTGCTAACAAAACCCAATCTTTGC -3'

Sequencing Primer
(F):5'- AAGACGCTTCTGGCTCACTTTTG -3'
(R):5'- TTGCATTTCCAGAACAACTGC -3'
Posted On2019-12-09