Incidental Mutation 'R7821:Hoxb9'
ID628643
Institutional Source Beutler Lab
Gene Symbol Hoxb9
Ensembl Gene ENSMUSG00000020875
Gene Namehomeobox B9
SynonymsHox-2.5
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.698) question?
Stock #R7821 (G1)
Quality Score78.0075
Status Validated
Chromosome11
Chromosomal Location96271457-96276595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to G at 96271711 bp
ZygosityHeterozygous
Amino Acid Change Proline to Arginine at position 57 (P57R)
Ref Sequence ENSEMBL: ENSMUSP00000133919 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000010] [ENSMUST00000174042]
Predicted Effect probably damaging
Transcript: ENSMUST00000000010
AA Change: P57R

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000000010
Gene: ENSMUSG00000020875
AA Change: P57R

DomainStartEndE-ValueType
Pfam:Hox9_act 1 172 2.1e-59 PFAM
HOX 185 247 2.68e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174042
AA Change: P57R

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000133919
Gene: ENSMUSG00000020875
AA Change: P57R

DomainStartEndE-ValueType
Pfam:Hox9_act 1 96 5e-42 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the Abd-B homeobox family and encodes a protein with a homeobox DNA-binding domain. It is included in a cluster of homeobox B genes located on chromosome 17. The encoded nuclear protein functions as a sequence-specific transcription factor that is involved in cell proliferation and differentiation. Increased expression of this gene is associated with some cases of leukemia, prostate cancer and lung cancer. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mutations affect developing thoracic skeletal elements. Homozygotes exhibit rib fusion, abnormal rib attachment to the sternum, and reduced intercostal segments of the sternum. Homozygotes or heterozygotes may show an eighth rib attached to the sternum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,050 Q81R possibly damaging Het
5830473C10Rik T C 5: 90,592,888 V560A possibly damaging Het
Aass T A 6: 23,120,930 T112S probably damaging Het
Abca12 G T 1: 71,259,791 S2320R probably benign Het
Abca7 TGGTGCGTGAG TG 10: 80,002,590 probably benign Het
Adh7 T A 3: 138,226,375 I250N probably damaging Het
Aoc1 T A 6: 48,905,811 I229N probably damaging Het
C2cd6 A T 1: 59,067,792 Y291* probably null Het
Cacnb4 T C 2: 52,434,508 D514G possibly damaging Het
Clec2g A G 6: 128,948,777 T50A probably benign Het
Col6a5 T C 9: 105,864,259 E2487G probably damaging Het
D130040H23Rik A T 8: 69,300,235 probably null Het
D6Ertd527e G A 6: 87,110,897 S14N unknown Het
Dchs1 G A 7: 105,765,145 T821I probably benign Het
Dhcr24 T C 4: 106,571,436 S138P possibly damaging Het
Dhrs9 G A 2: 69,394,438 G157R probably damaging Het
Dnah5 T A 15: 28,411,532 D3682E possibly damaging Het
Dst T C 1: 34,275,362 probably null Het
Fat1 A T 8: 44,950,224 H4L probably benign Het
Flnb A G 14: 7,939,113 I2319V probably benign Het
Foxe1 T C 4: 46,344,578 W129R probably damaging Het
Foxred2 G A 15: 77,943,350 P603L probably benign Het
Fshr A G 17: 88,986,213 S346P probably damaging Het
Galnt2 T A 8: 124,343,395 S550R possibly damaging Het
Gpc2 A G 5: 138,276,297 S312P probably benign Het
Gpr150 C A 13: 76,056,392 A145S probably benign Het
Grk4 T A 5: 34,710,209 W173R probably damaging Het
Hsf5 A G 11: 87,638,128 Q563R probably benign Het
Ighv1-58 A G 12: 115,312,176 F114S possibly damaging Het
Klra9 T A 6: 130,185,600 I158F probably damaging Het
Lrrc8d T C 5: 105,812,344 S207P probably damaging Het
Nbeal2 T C 9: 110,630,252 E1929G probably damaging Het
Ncoa1 A G 12: 4,296,221 M89T probably benign Het
Nkx2-4 T C 2: 147,085,288 I20V probably benign Het
Nup214 T C 2: 32,026,905 S1191P possibly damaging Het
Olfr136 A G 17: 38,335,964 D269G probably benign Het
Pfkp T A 13: 6,597,872 N556I probably damaging Het
Pidd1 A T 7: 141,442,280 S199T probably benign Het
Pik3r2 T A 8: 70,769,764 I515F probably damaging Het
Plcxd2 T A 16: 45,965,161 I294F probably damaging Het
Prmt6 C A 3: 110,250,987 probably benign Het
Prpf8 A G 11: 75,494,474 I812V probably benign Het
Rasa2 T C 9: 96,580,484 probably null Het
Rsad1 A C 11: 94,544,462 D266E probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Shroom3 T A 5: 92,940,846 V485E probably damaging Het
Siae T A 9: 37,644,900 Y451N probably damaging Het
Slc7a11 A T 3: 50,381,027 I354N probably damaging Het
Spryd7 A T 14: 61,545,680 probably null Het
Srcap A G 7: 127,530,327 probably benign Het
Svep1 T A 4: 58,179,601 D214V probably damaging Het
Tmtc4 T C 14: 122,971,877 I119V probably benign Het
Trim5 G A 7: 104,278,426 T169I probably benign Het
Ttc33 T C 15: 5,212,025 F83S probably benign Het
Ubr5 A T 15: 37,997,187 S1741T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdcp A G 12: 4,857,975 N694S probably benign Het
Zfp174 T A 16: 3,848,177 I102N probably damaging Het
Zfp354a T C 11: 51,069,712 F248S probably damaging Het
Zfyve26 A T 12: 79,255,324 C404S probably damaging Het
Zmynd8 A T 2: 165,881,080 probably benign Het
Other mutations in Hoxb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01487:Hoxb9 APN 11 96274788 nonsense probably null
IGL02251:Hoxb9 APN 11 96274825 missense probably damaging 1.00
IGL02738:Hoxb9 APN 11 96274728 missense possibly damaging 0.87
R1467:Hoxb9 UTSW 11 96271938 missense probably benign
R1467:Hoxb9 UTSW 11 96271938 missense probably benign
R1958:Hoxb9 UTSW 11 96272054 missense possibly damaging 0.88
R4419:Hoxb9 UTSW 11 96271981 missense probably benign 0.00
R4420:Hoxb9 UTSW 11 96271981 missense probably benign 0.00
R4666:Hoxb9 UTSW 11 96274831 missense possibly damaging 0.94
R7627:Hoxb9 UTSW 11 96274695 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTCCATTTCTGGGACGC -3'
(R):5'- TTTCCAAACTGTACTCGGGC -3'

Sequencing Primer
(F):5'- GACGCTTAGCAGCTATTATGTCGAC -3'
(R):5'- TGCCCTGTTTGAGCAGC -3'
Posted On2020-06-01