Incidental Mutation 'R7821:Lrrc8d'
ID601859
Institutional Source Beutler Lab
Gene Symbol Lrrc8d
Ensembl Gene ENSMUSG00000046079
Gene Nameleucine rich repeat containing 8D
SynonymsLrrc5, 2810473G09Rik, 4930525N13Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7821 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location105699969-105832436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105812344 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 207 (S207P)
Ref Sequence ENSEMBL: ENSMUSP00000113603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060531] [ENSMUST00000120847] [ENSMUST00000127686] [ENSMUST00000154807] [ENSMUST00000156630]
Predicted Effect probably damaging
Transcript: ENSMUST00000060531
AA Change: S207P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057293
Gene: ENSMUSG00000046079
AA Change: S207P

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 5.6e-31 PFAM
Pfam:DUF3733 138 197 2e-24 PFAM
transmembrane domain 366 388 N/A INTRINSIC
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120847
AA Change: S207P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113603
Gene: ENSMUSG00000046079
AA Change: S207P

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 385 2.2e-160 PFAM
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127686
Predicted Effect probably benign
Transcript: ENSMUST00000154807
SMART Domains Protein: ENSMUSP00000114662
Gene: ENSMUSG00000046079

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,050 Q81R possibly damaging Het
5830473C10Rik T C 5: 90,592,888 V560A possibly damaging Het
Aass T A 6: 23,120,930 T112S probably damaging Het
Abca12 G T 1: 71,259,791 S2320R probably benign Het
Abca7 TGGTGCGTGAG TG 10: 80,002,590 probably benign Het
Adh7 T A 3: 138,226,375 I250N probably damaging Het
Aoc1 T A 6: 48,905,811 I229N probably damaging Het
C2cd6 A T 1: 59,067,792 Y291* probably null Het
Cacnb4 T C 2: 52,434,508 D514G possibly damaging Het
Clec2g A G 6: 128,948,777 T50A probably benign Het
Col6a5 T C 9: 105,864,259 E2487G probably damaging Het
D6Ertd527e G A 6: 87,110,897 S14N unknown Het
Dchs1 G A 7: 105,765,145 T821I probably benign Het
Dhcr24 T C 4: 106,571,436 S138P possibly damaging Het
Dhrs9 G A 2: 69,394,438 G157R probably damaging Het
Dnah5 T A 15: 28,411,532 D3682E possibly damaging Het
Dst T C 1: 34,275,362 probably null Het
Fat1 A T 8: 44,950,224 H4L probably benign Het
Flnb A G 14: 7,939,113 I2319V probably benign Het
Foxe1 T C 4: 46,344,578 W129R probably damaging Het
Fshr A G 17: 88,986,213 S346P probably damaging Het
Galnt2 T A 8: 124,343,395 S550R possibly damaging Het
Gpc2 A G 5: 138,276,297 S312P probably benign Het
Gpr150 C A 13: 76,056,392 A145S probably benign Het
Grk4 T A 5: 34,710,209 W173R probably damaging Het
Hsf5 A G 11: 87,638,128 Q563R probably benign Het
Ighv1-58 A G 12: 115,312,176 F114S possibly damaging Het
Klra9 T A 6: 130,185,600 I158F probably damaging Het
Nbeal2 T C 9: 110,630,252 E1929G probably damaging Het
Ncoa1 A G 12: 4,296,221 M89T probably benign Het
Nkx2-4 T C 2: 147,085,288 I20V probably benign Het
Nup214 T C 2: 32,026,905 S1191P possibly damaging Het
Olfr136 A G 17: 38,335,964 D269G probably benign Het
Peg10 GAT GATCAT 6: 4,756,449 probably benign Het
Pfkp T A 13: 6,597,872 N556I probably damaging Het
Pidd1 A T 7: 141,442,280 S199T probably benign Het
Pik3r2 T A 8: 70,769,764 I515F probably damaging Het
Plcxd2 T A 16: 45,965,161 I294F probably damaging Het
Prmt6 C A 3: 110,250,987 probably benign Het
Prpf8 A G 11: 75,494,474 I812V probably benign Het
Rsad1 A C 11: 94,544,462 D266E probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Shroom3 T A 5: 92,940,846 V485E probably damaging Het
Siae T A 9: 37,644,900 Y451N probably damaging Het
Slc7a11 A T 3: 50,381,027 I354N probably damaging Het
Spryd7 A T 14: 61,545,680 probably null Het
Srcap A G 7: 127,530,327 probably benign Het
Svep1 T A 4: 58,179,601 D214V probably damaging Het
Tmtc4 T C 14: 122,971,877 I119V probably benign Het
Trim5 G A 7: 104,278,426 T169I probably benign Het
Ttc33 T C 15: 5,212,025 F83S probably benign Het
Ubr5 A T 15: 37,997,187 S1741T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdcp A G 12: 4,857,975 N694S probably benign Het
Zfp174 T A 16: 3,848,177 I102N probably damaging Het
Zfp354a T C 11: 51,069,712 F248S probably damaging Het
Zfyve26 A T 12: 79,255,324 C404S probably damaging Het
Other mutations in Lrrc8d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Lrrc8d APN 5 105811952 missense possibly damaging 0.60
IGL01327:Lrrc8d APN 5 105812265 missense probably damaging 1.00
IGL02148:Lrrc8d APN 5 105812387 missense possibly damaging 0.92
IGL02228:Lrrc8d APN 5 105811864 missense probably benign 0.44
IGL02551:Lrrc8d APN 5 105813548 missense possibly damaging 0.78
IGL02605:Lrrc8d APN 5 105826817 intron noncoding transcript
R0415:Lrrc8d UTSW 5 105811865 missense probably damaging 1.00
R1424:Lrrc8d UTSW 5 105826916 missense unknown
R1754:Lrrc8d UTSW 5 105812657 missense probably benign
R3411:Lrrc8d UTSW 5 105826706 intron noncoding transcript
R3605:Lrrc8d UTSW 5 105827007 missense unknown
R3705:Lrrc8d UTSW 5 105813475 missense probably damaging 1.00
R3798:Lrrc8d UTSW 5 105812489 missense probably benign 0.12
R3951:Lrrc8d UTSW 5 105814276 missense probably benign 0.00
R4300:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R4953:Lrrc8d UTSW 5 105813368 missense probably damaging 1.00
R5211:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R5436:Lrrc8d UTSW 5 105812552 missense probably damaging 0.98
R5512:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5512:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5514:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5514:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5531:Lrrc8d UTSW 5 105797670 intron probably benign
R5929:Lrrc8d UTSW 5 105812606 missense probably damaging 0.98
R6063:Lrrc8d UTSW 5 105812126 missense probably benign 0.01
R6379:Lrrc8d UTSW 5 105812809 missense probably benign 0.08
R6431:Lrrc8d UTSW 5 105811760 missense probably damaging 1.00
R7127:Lrrc8d UTSW 5 105812963 missense probably damaging 1.00
R7682:Lrrc8d UTSW 5 105812791 missense probably damaging 1.00
RF003:Lrrc8d UTSW 5 105812641 missense probably damaging 1.00
X0024:Lrrc8d UTSW 5 105811745 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAACTTGGATTTTCAGCAGTAC -3'
(R):5'- TGCTGGGAACTTCGATCACC -3'

Sequencing Primer
(F):5'- TCAGCAGTACGTATTTATCAATCAG -3'
(R):5'- GGGAACTTCGATCACCGGTTTC -3'
Posted On2019-12-03