Incidental Mutation 'R7821:Lrrc8d'
ID601859
Institutional Source Beutler Lab
Gene Symbol Lrrc8d
Ensembl Gene ENSMUSG00000046079
Gene Nameleucine rich repeat containing 8D
SynonymsLrrc5, 2810473G09Rik, 4930525N13Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7821 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location105699969-105832436 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105812344 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 207 (S207P)
Ref Sequence ENSEMBL: ENSMUSP00000113603 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060531] [ENSMUST00000120847] [ENSMUST00000127686] [ENSMUST00000154807] [ENSMUST00000156630]
Predicted Effect probably damaging
Transcript: ENSMUST00000060531
AA Change: S207P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000057293
Gene: ENSMUSG00000046079
AA Change: S207P

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 5.6e-31 PFAM
Pfam:DUF3733 138 197 2e-24 PFAM
transmembrane domain 366 388 N/A INTRINSIC
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000120847
AA Change: S207P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113603
Gene: ENSMUSG00000046079
AA Change: S207P

DomainStartEndE-ValueType
Pfam:Pannexin_like 1 385 2.2e-160 PFAM
internal_repeat_1 490 607 1.13e-8 PROSPERO
LRR 658 681 1.23e0 SMART
LRR 683 705 2.03e1 SMART
LRR_TYP 706 729 9.58e-3 SMART
LRR 730 751 2.47e2 SMART
LRR 752 775 1.76e-1 SMART
LRR 776 797 1.01e2 SMART
LRR 798 821 3.29e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000127686
Predicted Effect probably benign
Transcript: ENSMUST00000154807
SMART Domains Protein: ENSMUSP00000114662
Gene: ENSMUSG00000046079

DomainStartEndE-ValueType
Pfam:DUF3733 1 65 1.8e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156630
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency 98% (61/62)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921530L21Rik A G 14: 95,882,050 Q81R possibly damaging Het
5830473C10Rik T C 5: 90,592,888 V560A possibly damaging Het
Aass T A 6: 23,120,930 T112S probably damaging Het
Abca12 G T 1: 71,259,791 S2320R probably benign Het
Abca7 TGGTGCGTGAG TG 10: 80,002,590 probably benign Het
Adh7 T A 3: 138,226,375 I250N probably damaging Het
Aoc1 T A 6: 48,905,811 I229N probably damaging Het
C2cd6 A T 1: 59,067,792 Y291* probably null Het
Cacnb4 T C 2: 52,434,508 D514G possibly damaging Het
Clec2g A G 6: 128,948,777 T50A probably benign Het
Col6a5 T C 9: 105,864,259 E2487G probably damaging Het
D130040H23Rik A T 8: 69,300,235 probably null Het
D6Ertd527e G A 6: 87,110,897 S14N unknown Het
Dchs1 G A 7: 105,765,145 T821I probably benign Het
Dhcr24 T C 4: 106,571,436 S138P possibly damaging Het
Dhrs9 G A 2: 69,394,438 G157R probably damaging Het
Dnah5 T A 15: 28,411,532 D3682E possibly damaging Het
Dst T C 1: 34,275,362 probably null Het
Fat1 A T 8: 44,950,224 H4L probably benign Het
Flnb A G 14: 7,939,113 I2319V probably benign Het
Foxe1 T C 4: 46,344,578 W129R probably damaging Het
Foxred2 G A 15: 77,943,350 P603L probably benign Het
Fshr A G 17: 88,986,213 S346P probably damaging Het
Galnt2 T A 8: 124,343,395 S550R possibly damaging Het
Gpc2 A G 5: 138,276,297 S312P probably benign Het
Gpr150 C A 13: 76,056,392 A145S probably benign Het
Grk4 T A 5: 34,710,209 W173R probably damaging Het
Hoxb9 C G 11: 96,271,711 P57R probably damaging Het
Hsf5 A G 11: 87,638,128 Q563R probably benign Het
Ighv1-58 A G 12: 115,312,176 F114S possibly damaging Het
Klra9 T A 6: 130,185,600 I158F probably damaging Het
Nbeal2 T C 9: 110,630,252 E1929G probably damaging Het
Ncoa1 A G 12: 4,296,221 M89T probably benign Het
Nkx2-4 T C 2: 147,085,288 I20V probably benign Het
Nup214 T C 2: 32,026,905 S1191P possibly damaging Het
Olfr136 A G 17: 38,335,964 D269G probably benign Het
Pfkp T A 13: 6,597,872 N556I probably damaging Het
Pidd1 A T 7: 141,442,280 S199T probably benign Het
Pik3r2 T A 8: 70,769,764 I515F probably damaging Het
Plcxd2 T A 16: 45,965,161 I294F probably damaging Het
Prmt6 C A 3: 110,250,987 probably benign Het
Prpf8 A G 11: 75,494,474 I812V probably benign Het
Rasa2 T C 9: 96,580,484 probably null Het
Rsad1 A C 11: 94,544,462 D266E probably benign Het
Rsf1 GGCG GGCGACGGCTGCG 7: 97,579,906 probably benign Het
Shroom3 T A 5: 92,940,846 V485E probably damaging Het
Siae T A 9: 37,644,900 Y451N probably damaging Het
Slc7a11 A T 3: 50,381,027 I354N probably damaging Het
Spryd7 A T 14: 61,545,680 probably null Het
Srcap A G 7: 127,530,327 probably benign Het
Svep1 T A 4: 58,179,601 D214V probably damaging Het
Tmtc4 T C 14: 122,971,877 I119V probably benign Het
Trim5 G A 7: 104,278,426 T169I probably benign Het
Ttc33 T C 15: 5,212,025 F83S probably benign Het
Ubr5 A T 15: 37,997,187 S1741T probably damaging Het
Vmn2r111 T C 17: 22,559,051 N549S possibly damaging Het
Wdcp A G 12: 4,857,975 N694S probably benign Het
Zfp174 T A 16: 3,848,177 I102N probably damaging Het
Zfp354a T C 11: 51,069,712 F248S probably damaging Het
Zfyve26 A T 12: 79,255,324 C404S probably damaging Het
Zmynd8 A T 2: 165,881,080 probably benign Het
Other mutations in Lrrc8d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00765:Lrrc8d APN 5 105811952 missense possibly damaging 0.60
IGL01327:Lrrc8d APN 5 105812265 missense probably damaging 1.00
IGL02148:Lrrc8d APN 5 105812387 missense possibly damaging 0.92
IGL02228:Lrrc8d APN 5 105811864 missense probably benign 0.44
IGL02551:Lrrc8d APN 5 105813548 missense possibly damaging 0.78
IGL02605:Lrrc8d APN 5 105826817 intron noncoding transcript
BB009:Lrrc8d UTSW 5 105813025 missense probably damaging 1.00
BB019:Lrrc8d UTSW 5 105813025 missense probably damaging 1.00
R0415:Lrrc8d UTSW 5 105811865 missense probably damaging 1.00
R1424:Lrrc8d UTSW 5 105826916 missense unknown
R1754:Lrrc8d UTSW 5 105812657 missense probably benign
R3411:Lrrc8d UTSW 5 105826706 intron noncoding transcript
R3605:Lrrc8d UTSW 5 105827007 missense unknown
R3705:Lrrc8d UTSW 5 105813475 missense probably damaging 1.00
R3798:Lrrc8d UTSW 5 105812489 missense probably benign 0.12
R3951:Lrrc8d UTSW 5 105814276 missense probably benign 0.00
R4300:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R4953:Lrrc8d UTSW 5 105813368 missense probably damaging 1.00
R5211:Lrrc8d UTSW 5 105813740 missense probably damaging 0.99
R5436:Lrrc8d UTSW 5 105812552 missense probably damaging 0.98
R5512:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5512:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5514:Lrrc8d UTSW 5 105812784 missense probably damaging 1.00
R5514:Lrrc8d UTSW 5 105812785 missense probably benign 0.00
R5531:Lrrc8d UTSW 5 105797670 intron probably benign
R5929:Lrrc8d UTSW 5 105812606 missense probably damaging 0.98
R6063:Lrrc8d UTSW 5 105812126 missense probably benign 0.01
R6379:Lrrc8d UTSW 5 105812809 missense probably benign 0.08
R6431:Lrrc8d UTSW 5 105811760 missense probably damaging 1.00
R7127:Lrrc8d UTSW 5 105812963 missense probably damaging 1.00
R7682:Lrrc8d UTSW 5 105812791 missense probably damaging 1.00
R7932:Lrrc8d UTSW 5 105813025 missense probably damaging 1.00
R8528:Lrrc8d UTSW 5 105812486 missense probably benign 0.22
RF003:Lrrc8d UTSW 5 105812641 missense probably damaging 1.00
X0024:Lrrc8d UTSW 5 105811745 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CCAACTTGGATTTTCAGCAGTAC -3'
(R):5'- TGCTGGGAACTTCGATCACC -3'

Sequencing Primer
(F):5'- TCAGCAGTACGTATTTATCAATCAG -3'
(R):5'- GGGAACTTCGATCACCGGTTTC -3'
Posted On2019-12-03