Incidental Mutation 'R8144:Mamdc4'
ID632673
Institutional Source Beutler Lab
Gene Symbol Mamdc4
Ensembl Gene ENSMUSG00000026941
Gene NameMAM domain containing 4
SynonymsLOC381352
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R8144 (G1)
Quality Score213.009
Status Not validated
Chromosome2
Chromosomal Location25563115-25574845 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 25567007 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 590 (V590E)
Ref Sequence ENSEMBL: ENSMUSP00000092735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015236] [ENSMUST00000095117] [ENSMUST00000114223]
Predicted Effect probably benign
Transcript: ENSMUST00000015236
SMART Domains Protein: ENSMUSP00000015236
Gene: ENSMUSG00000015092

DomainStartEndE-ValueType
Pfam:MBF1 4 73 4.6e-29 PFAM
HTH_XRE 80 135 1.02e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000095117
AA Change: V590E

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000092735
Gene: ENSMUSG00000026941
AA Change: V590E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
LDLa 32 58 7.33e-1 SMART
MAM 66 227 3.56e-52 SMART
LDLa 233 272 3.5e-9 SMART
MAM 254 430 3.87e-53 SMART
LDLa 461 497 2.63e-4 SMART
MAM 493 653 5.33e-5 SMART
MAM 660 819 3.68e-68 SMART
MAM 820 979 1.07e-28 SMART
MAM 980 1148 2.07e-62 SMART
transmembrane domain 1165 1187 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114223
AA Change: V586E

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109861
Gene: ENSMUSG00000026941
AA Change: V586E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 28 54 7.33e-1 SMART
MAM 62 223 3.56e-52 SMART
LDLa 229 268 3.5e-9 SMART
MAM 250 426 3.87e-53 SMART
LDLa 457 493 2.63e-4 SMART
MAM 489 649 5.33e-5 SMART
MAM 656 815 3.68e-68 SMART
MAM 816 975 1.07e-28 SMART
MAM 976 1144 2.07e-62 SMART
transmembrane domain 1161 1183 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152237
SMART Domains Protein: ENSMUSP00000119789
Gene: ENSMUSG00000026941

DomainStartEndE-ValueType
LDLa 9 35 7.33e-1 SMART
MAM 43 204 3.56e-52 SMART
LDLa 210 249 3.5e-9 SMART
MAM 231 407 3.87e-53 SMART
LDLa 438 474 2.63e-4 SMART
MAM 558 717 2.27e-68 SMART
MAM 718 877 1.07e-28 SMART
MAM 878 1046 2.07e-62 SMART
transmembrane domain 1063 1085 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.7%
  • 3x: 99.4%
  • 10x: 98.0%
  • 20x: 90.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 44 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik A C 9: 57,259,105 probably benign Het
3110002H16Rik A T 18: 12,185,647 probably null Het
4932415D10Rik A T 10: 82,294,599 L859* probably null Het
A2ml1 T C 6: 128,569,999 D389G possibly damaging Het
Adcy2 G A 13: 68,734,635 Q328* probably null Het
Arhgef40 T A 14: 51,998,175 V1171E probably damaging Het
Atxn1l G A 8: 109,732,601 A343V probably benign Het
C3 A T 17: 57,226,276 V109E probably damaging Het
Clptm1 A T 7: 19,633,902 V595E possibly damaging Het
Cpne6 T C 14: 55,512,609 C66R possibly damaging Het
Dhrs3 T C 4: 144,919,904 S175P probably damaging Het
Eif2b1 A T 5: 124,573,145 M187K probably damaging Het
Eln CTCCAGCTCCGAT C 5: 134,729,149 probably benign Het
Evc2 T C 5: 37,380,567 L533P probably damaging Het
Fam221b T G 4: 43,665,465 Q331P probably damaging Het
Fam221b G T 4: 43,665,466 Q331K probably benign Het
Gm14412 G T 2: 177,314,722 T460K probably damaging Het
Golga3 T C 5: 110,185,879 V127A probably damaging Het
Itsn1 C T 16: 91,912,005 P1719L unknown Het
Kdelc1 A G 1: 44,110,806 Y408H probably damaging Het
Lars T G 18: 42,218,526 H871P probably damaging Het
Mdga2 A G 12: 66,655,263 I457T probably damaging Het
Morc2a T C 11: 3,684,039 V717A probably benign Het
Olfr406 C A 11: 74,269,558 H56Q probably damaging Het
Olfr926 A T 9: 38,877,366 L63F probably damaging Het
Pank4 A T 4: 154,970,080 Q170L probably benign Het
Pde4dip G T 3: 97,715,426 A1489D probably damaging Het
Pex16 A C 2: 92,375,640 E26A probably damaging Het
Polq C T 16: 37,029,484 P367S probably benign Het
Polr1a T A 6: 71,950,616 V817E probably benign Het
Pthlh T C 6: 147,257,165 D99G probably damaging Het
Rasgrp4 A T 7: 29,149,117 S556C probably damaging Het
Rhobtb1 G T 10: 69,289,558 V653L possibly damaging Het
Rin2 G A 2: 145,822,305 R33Q probably benign Het
Sh3rf2 C T 18: 42,141,059 T430I probably benign Het
Slc14a2 A G 18: 78,184,544 probably null Het
Slc39a8 C T 3: 135,884,643 Q366* probably null Het
Tagln3 G T 16: 45,724,191 A39D probably benign Het
Tfdp1 T A 8: 13,373,015 C307S probably benign Het
Tlr11 T C 14: 50,362,488 S644P probably damaging Het
Tnpo3 T C 6: 29,558,762 D723G probably benign Het
Xpo5 A G 17: 46,208,219 N195D probably benign Het
Zfp11 T C 5: 129,656,630 Y589C possibly damaging Het
Zfp712 T C 13: 67,041,108 T452A probably benign Het
Other mutations in Mamdc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01304:Mamdc4 APN 2 25563576 missense possibly damaging 0.53
IGL01994:Mamdc4 APN 2 25568534 missense possibly damaging 0.64
IGL02072:Mamdc4 APN 2 25568339 missense probably damaging 1.00
IGL02193:Mamdc4 APN 2 25564446 missense probably benign 0.02
IGL02673:Mamdc4 APN 2 25570054 missense probably benign
IGL03048:Mamdc4 UTSW 2 25569072 missense possibly damaging 0.67
R0135:Mamdc4 UTSW 2 25566920 missense possibly damaging 0.71
R0481:Mamdc4 UTSW 2 25571216 start codon destroyed probably null 0.08
R0490:Mamdc4 UTSW 2 25563581 missense probably benign 0.01
R0609:Mamdc4 UTSW 2 25564193 missense probably benign 0.30
R0729:Mamdc4 UTSW 2 25570036 missense probably damaging 0.98
R1365:Mamdc4 UTSW 2 25566024 missense probably damaging 1.00
R1533:Mamdc4 UTSW 2 25569747 missense possibly damaging 0.71
R1671:Mamdc4 UTSW 2 25568223 nonsense probably null
R1789:Mamdc4 UTSW 2 25567622 missense possibly damaging 0.59
R2002:Mamdc4 UTSW 2 25567232 missense probably damaging 1.00
R2013:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2014:Mamdc4 UTSW 2 25563572 missense probably damaging 0.98
R2056:Mamdc4 UTSW 2 25564168 missense probably benign 0.18
R2109:Mamdc4 UTSW 2 25569390 missense probably damaging 1.00
R2128:Mamdc4 UTSW 2 25569258 missense probably damaging 1.00
R2185:Mamdc4 UTSW 2 25569692 critical splice donor site probably null
R2473:Mamdc4 UTSW 2 25566332 missense probably damaging 0.99
R2496:Mamdc4 UTSW 2 25565902 missense probably damaging 1.00
R3818:Mamdc4 UTSW 2 25565773 missense probably benign
R4591:Mamdc4 UTSW 2 25564597 missense possibly damaging 0.87
R4829:Mamdc4 UTSW 2 25565356 missense possibly damaging 0.85
R4898:Mamdc4 UTSW 2 25570023 missense probably damaging 0.98
R5209:Mamdc4 UTSW 2 25566923 missense probably damaging 0.97
R5268:Mamdc4 UTSW 2 25564690 missense possibly damaging 0.95
R5490:Mamdc4 UTSW 2 25565878 missense probably damaging 1.00
R6152:Mamdc4 UTSW 2 25567439 missense probably damaging 1.00
R6234:Mamdc4 UTSW 2 25570080 missense probably damaging 1.00
R6681:Mamdc4 UTSW 2 25567744 missense probably damaging 1.00
R6774:Mamdc4 UTSW 2 25566936 missense probably benign 0.06
R7178:Mamdc4 UTSW 2 25568965 missense probably benign 0.04
R7225:Mamdc4 UTSW 2 25565546 missense possibly damaging 0.50
R7451:Mamdc4 UTSW 2 25564461 missense possibly damaging 0.80
R7520:Mamdc4 UTSW 2 25565348 missense possibly damaging 0.88
R7627:Mamdc4 UTSW 2 25568213 missense probably damaging 1.00
R7875:Mamdc4 UTSW 2 25568665 nonsense probably null
R8041:Mamdc4 UTSW 2 25564695 missense probably damaging 1.00
R8201:Mamdc4 UTSW 2 25566081 missense probably damaging 1.00
R8213:Mamdc4 UTSW 2 25566356 missense probably benign 0.17
X0022:Mamdc4 UTSW 2 25570192 missense probably damaging 1.00
X0025:Mamdc4 UTSW 2 25564686 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- CAGCTTTAGGCAGATAGGGG -3'
(R):5'- TCCTATCTCTGCAGAAGGCC -3'

Sequencing Primer
(F):5'- GAGAACGACTGTCAGTTAGGGGC -3'
(R):5'- AGCTAAGATCTGAGGCCCG -3'
Posted On2020-06-30