Incidental Mutation 'R8204:4933427D14Rik'
ID635826
Institutional Source Beutler Lab
Gene Symbol 4933427D14Rik
Ensembl Gene ENSMUSG00000020807
Gene NameRIKEN cDNA 4933427D14 gene
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R8204 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location72153929-72207459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 72166780 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 731 (R731H)
Ref Sequence ENSEMBL: ENSMUSP00000104146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108506] [ENSMUST00000131546] [ENSMUST00000142530]
Predicted Effect probably benign
Transcript: ENSMUST00000108506
AA Change: R731H

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000104146
Gene: ENSMUSG00000020807
AA Change: R731H

DomainStartEndE-ValueType
Pfam:DUF4673 1 954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131546
SMART Domains Protein: ENSMUSP00000122273
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
coiled coil region 625 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142530
SMART Domains Protein: ENSMUSP00000115276
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.0%
Validation Efficiency 98% (51/52)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrbk2 A G 5: 112,957,359 F171L probably benign Het
Arpp21 T A 9: 112,136,570 Y408F noncoding transcript Het
Atr T C 9: 95,935,513 S2086P Het
BC034090 C A 1: 155,241,742 G210V probably damaging Het
Cdk6 A G 5: 3,344,461 D32G probably damaging Het
Cep126 C T 9: 8,120,780 E81K probably damaging Het
Clec4d T A 6: 123,265,364 V25D probably damaging Het
Cox8a A G 19: 7,215,480 I40T probably benign Het
D430042O09Rik C T 7: 125,850,742 R993C probably damaging Het
Dlg5 A G 14: 24,160,252 L792P probably damaging Het
Egln3 T C 12: 54,203,224 Y113C probably benign Het
Exoc6b C T 6: 84,855,522 V397M probably damaging Het
Fat2 A T 11: 55,284,610 L1759Q probably benign Het
Flg2 T A 3: 93,202,767 S701T unknown Het
Fopnl T C 16: 14,300,206 D150G probably benign Het
Git1 G A 11: 77,505,335 D551N probably benign Het
Gpr137 C T 19: 6,940,378 A21T probably benign Het
Hk1 A G 10: 62,296,744 F175S probably damaging Het
Hoxc13 A G 15: 102,927,360 N308D probably damaging Het
Itga9 A G 9: 118,871,921 N924S probably damaging Het
Klhl20 T C 1: 161,106,844 M202V probably benign Het
Krtap19-9a C T 16: 88,924,108 G37D noncoding transcript Het
Lancl2 C A 6: 57,737,716 P440Q probably damaging Het
Lrba T C 3: 86,315,403 I608T possibly damaging Het
Lrtm2 T A 6: 119,317,408 E254V probably benign Het
Magi3 A T 3: 104,051,186 C528S probably benign Het
Mast3 T C 8: 70,788,281 D224G probably benign Het
Mfsd7c GTAGTGTATA GTA 12: 85,803,148 probably null Het
Myl10 G C 5: 136,697,971 V70L probably benign Het
Myrip G A 9: 120,432,979 probably null Het
Olfr1278 A G 2: 111,293,140 R291G probably damaging Het
Olfr313 A C 11: 58,817,059 D17A probably benign Het
Plekhg6 C T 6: 125,363,498 R633H probably damaging Het
Ppp1r7 T C 1: 93,365,011 V344A possibly damaging Het
Ppp2r1a A G 17: 20,956,773 E191G probably benign Het
Prkag2 T C 5: 24,869,127 probably null Het
Pyroxd2 A T 19: 42,749,388 V48E probably benign Het
Sacs T C 14: 61,212,948 S4148P probably damaging Het
Sh3tc2 T C 18: 61,953,129 F5S probably damaging Het
Skint8 T C 4: 111,938,893 S255P probably benign Het
Tacc2 A T 7: 130,624,429 Q948L probably damaging Het
Tcerg1 T A 18: 42,574,553 L1046Q probably damaging Het
Tcof1 G C 18: 60,829,051 A702G possibly damaging Het
Tfcp2 G T 15: 100,522,448 Q169K possibly damaging Het
Tpp1 A T 7: 105,750,315 L82Q probably damaging Het
Trpc7 A G 13: 56,783,796 S697P probably benign Het
Vmn1r55 A T 7: 5,147,286 I46N possibly damaging Het
Wdfy3 A G 5: 101,852,585 V2973A probably benign Het
Xrcc1 T C 7: 24,572,284 V564A possibly damaging Het
Other mutations in 4933427D14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:4933427D14Rik APN 11 72178504 missense probably damaging 1.00
IGL01643:4933427D14Rik APN 11 72191588 missense probably damaging 1.00
IGL02004:4933427D14Rik APN 11 72191597 missense possibly damaging 0.62
IGL02308:4933427D14Rik APN 11 72202482 missense probably damaging 1.00
IGL02378:4933427D14Rik APN 11 72189598 missense probably benign 0.02
IGL02715:4933427D14Rik APN 11 72198888 missense probably damaging 1.00
IGL03330:4933427D14Rik APN 11 72159428 missense probably damaging 1.00
IGL03384:4933427D14Rik APN 11 72195847 missense possibly damaging 0.87
BB002:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
BB012:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
IGL03047:4933427D14Rik UTSW 11 72166726 missense possibly damaging 0.74
R0114:4933427D14Rik UTSW 11 72195799 missense probably damaging 1.00
R0526:4933427D14Rik UTSW 11 72169783 missense probably damaging 1.00
R0653:4933427D14Rik UTSW 11 72175545 nonsense probably null
R0669:4933427D14Rik UTSW 11 72198845 missense possibly damaging 0.73
R0729:4933427D14Rik UTSW 11 72159455 missense probably benign 0.07
R1797:4933427D14Rik UTSW 11 72198459 missense possibly damaging 0.77
R3973:4933427D14Rik UTSW 11 72198741 missense probably damaging 1.00
R4744:4933427D14Rik UTSW 11 72175539 missense probably damaging 0.98
R4897:4933427D14Rik UTSW 11 72191516 missense probably damaging 1.00
R5023:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5057:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5100:4933427D14Rik UTSW 11 72166651 missense probably damaging 1.00
R5497:4933427D14Rik UTSW 11 72165534 missense probably benign 0.22
R5556:4933427D14Rik UTSW 11 72175200 splice site probably null
R5631:4933427D14Rik UTSW 11 72176764 missense possibly damaging 0.71
R5683:4933427D14Rik UTSW 11 72202440 missense probably benign
R5742:4933427D14Rik UTSW 11 72165553 missense possibly damaging 0.63
R6247:4933427D14Rik UTSW 11 72158942 missense probably benign 0.02
R6267:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6296:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6860:4933427D14Rik UTSW 11 72189586 missense probably damaging 1.00
R7023:4933427D14Rik UTSW 11 72178403 critical splice donor site probably null
R7328:4933427D14Rik UTSW 11 72169780 critical splice donor site probably null
R7514:4933427D14Rik UTSW 11 72195802 missense probably damaging 1.00
R7544:4933427D14Rik UTSW 11 72198939 missense probably damaging 1.00
R7925:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
R8280:4933427D14Rik UTSW 11 72195841 missense possibly damaging 0.70
R8316:4933427D14Rik UTSW 11 72168786 missense possibly damaging 0.70
R8366:4933427D14Rik UTSW 11 72176695 nonsense probably null
R8384:4933427D14Rik UTSW 11 72166765 missense probably benign 0.08
R8722:4933427D14Rik UTSW 11 72189596 missense probably benign 0.00
X0063:4933427D14Rik UTSW 11 72176769 missense probably benign
X0065:4933427D14Rik UTSW 11 72189575 missense possibly damaging 0.65
Z1176:4933427D14Rik UTSW 11 72159000 missense probably benign 0.12
Z1186:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1186:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1186:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195710 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1187:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1187:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1188:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1188:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1189:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1189:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1190:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1190:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1191:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1191:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1192:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1192:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTGCCGTATTGAGTATCAAC -3'
(R):5'- CCTGCTGACGGAGAAGTTTG -3'

Sequencing Primer
(F):5'- CCGTATTGAGTATCAACAGTGTG -3'
(R):5'- ATCACTGTGCTTTGGGGTA -3'
Posted On2020-07-13