Incidental Mutation 'R5683:4933427D14Rik'
ID443194
Institutional Source Beutler Lab
Gene Symbol 4933427D14Rik
Ensembl Gene ENSMUSG00000020807
Gene NameRIKEN cDNA 4933427D14 gene
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5683 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location72153929-72207459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 72202440 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Arginine at position 22 (M22R)
Ref Sequence ENSEMBL: ENSMUSP00000115276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108505] [ENSMUST00000108506] [ENSMUST00000131546] [ENSMUST00000142530] [ENSMUST00000204457]
Predicted Effect probably benign
Transcript: ENSMUST00000108505
AA Change: M22R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104145
Gene: ENSMUSG00000020807
AA Change: M22R

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108506
AA Change: M22R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000104146
Gene: ENSMUSG00000020807
AA Change: M22R

DomainStartEndE-ValueType
Pfam:DUF4673 1 954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131546
AA Change: M22R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122273
Gene: ENSMUSG00000020807
AA Change: M22R

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
coiled coil region 625 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142530
AA Change: M22R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000115276
Gene: ENSMUSG00000020807
AA Change: M22R

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144553
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154093
Predicted Effect probably benign
Transcript: ENSMUST00000204457
SMART Domains Protein: ENSMUSP00000144817
Gene: ENSMUSG00000107877

DomainStartEndE-ValueType
low complexity region 7 23 N/A INTRINSIC
low complexity region 26 43 N/A INTRINSIC
low complexity region 240 250 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 97.0%
  • 20x: 94.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acad11 A G 9: 104,084,283 E397G probably damaging Het
Actrt3 A T 3: 30,598,278 D222E probably benign Het
Akap11 A T 14: 78,512,578 S790T probably damaging Het
Arhgap5 T A 12: 52,519,586 D1113E probably benign Het
Arl2 C A 19: 6,134,764 R153L probably benign Het
B3glct T A 5: 149,696,437 M19K probably benign Het
Ccdc138 C A 10: 58,540,819 Q425K probably damaging Het
Ccdc178 T A 18: 22,130,122 K143N probably benign Het
Cd200r4 T A 16: 44,832,948 I73K probably benign Het
Chaf1b A G 16: 93,887,142 K94E possibly damaging Het
Cmtm2a T C 8: 104,293,044 probably null Het
Dnhd1 G A 7: 105,703,209 R2523Q probably damaging Het
Fnbp4 C A 2: 90,752,862 N277K probably damaging Het
Htr7 C A 19: 35,969,871 A248S probably damaging Het
Itsn1 T C 16: 91,905,380 Y37H probably benign Het
Kdm8 A G 7: 125,455,173 Y16C possibly damaging Het
Kif1b A T 4: 149,222,261 Y881N probably damaging Het
Lhcgr C T 17: 88,772,019 V80I probably benign Het
Lrriq1 T A 10: 103,173,375 L1082F probably damaging Het
Met A G 6: 17,571,744 Y1354C probably damaging Het
Nbea A G 3: 55,628,586 L2859P possibly damaging Het
Ndufaf5 T A 2: 140,202,923 M279K possibly damaging Het
Nlrp4e T C 7: 23,353,272 I872T probably damaging Het
Npnt A T 3: 132,906,840 probably null Het
Nsd1 G A 13: 55,246,148 V521I probably benign Het
Olfr138 G A 17: 38,275,546 M258I possibly damaging Het
Pak6 T A 2: 118,693,912 Y469N probably damaging Het
Parp4 C T 14: 56,647,429 R1322* probably null Het
Pax6 T C 2: 105,685,907 Y177H probably benign Het
Pcdhb4 A T 18: 37,308,989 T451S probably benign Het
Pcdhgb5 A T 18: 37,731,854 D234V probably damaging Het
Pramef6 A G 4: 143,895,853 S311P probably damaging Het
Ralb G A 1: 119,475,956 A147V possibly damaging Het
Rgs11 A G 17: 26,205,181 K196E probably benign Het
Rnft1 A T 11: 86,491,790 T280S probably benign Het
Slco4c1 G T 1: 96,867,834 H166Q probably damaging Het
Sycp3 T C 10: 88,472,935 S248P probably damaging Het
Tab2 A G 10: 7,919,112 probably null Het
Tgm6 T C 2: 130,138,955 M224T probably damaging Het
Topbp1 A T 9: 103,312,804 E193V possibly damaging Het
Trim36 T C 18: 46,169,292 Y551C probably damaging Het
Ttc17 T C 2: 94,362,521 Y628C probably damaging Het
Vmn1r180 A C 7: 23,953,210 D266A possibly damaging Het
Vmn2r104 T A 17: 20,040,719 K481* probably null Het
Zc3hav1 A G 6: 38,307,237 V981A probably damaging Het
Other mutations in 4933427D14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:4933427D14Rik APN 11 72178504 missense probably damaging 1.00
IGL01643:4933427D14Rik APN 11 72191588 missense probably damaging 1.00
IGL02004:4933427D14Rik APN 11 72191597 missense possibly damaging 0.62
IGL02308:4933427D14Rik APN 11 72202482 missense probably damaging 1.00
IGL02378:4933427D14Rik APN 11 72189598 missense probably benign 0.02
IGL02715:4933427D14Rik APN 11 72198888 missense probably damaging 1.00
IGL03330:4933427D14Rik APN 11 72159428 missense probably damaging 1.00
IGL03384:4933427D14Rik APN 11 72195847 missense possibly damaging 0.87
BB002:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
BB012:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
IGL03047:4933427D14Rik UTSW 11 72166726 missense possibly damaging 0.74
R0114:4933427D14Rik UTSW 11 72195799 missense probably damaging 1.00
R0526:4933427D14Rik UTSW 11 72169783 missense probably damaging 1.00
R0653:4933427D14Rik UTSW 11 72175545 nonsense probably null
R0669:4933427D14Rik UTSW 11 72198845 missense possibly damaging 0.73
R0729:4933427D14Rik UTSW 11 72159455 missense probably benign 0.07
R1797:4933427D14Rik UTSW 11 72198459 missense possibly damaging 0.77
R3973:4933427D14Rik UTSW 11 72198741 missense probably damaging 1.00
R4744:4933427D14Rik UTSW 11 72175539 missense probably damaging 0.98
R4897:4933427D14Rik UTSW 11 72191516 missense probably damaging 1.00
R5023:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5057:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5100:4933427D14Rik UTSW 11 72166651 missense probably damaging 1.00
R5497:4933427D14Rik UTSW 11 72165534 missense probably benign 0.22
R5556:4933427D14Rik UTSW 11 72175200 splice site probably null
R5631:4933427D14Rik UTSW 11 72176764 missense possibly damaging 0.71
R5742:4933427D14Rik UTSW 11 72165553 missense possibly damaging 0.63
R6247:4933427D14Rik UTSW 11 72158942 missense probably benign 0.02
R6267:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6296:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6860:4933427D14Rik UTSW 11 72189586 missense probably damaging 1.00
R7023:4933427D14Rik UTSW 11 72178403 critical splice donor site probably null
R7328:4933427D14Rik UTSW 11 72169780 critical splice donor site probably null
R7514:4933427D14Rik UTSW 11 72195802 missense probably damaging 1.00
R7544:4933427D14Rik UTSW 11 72198939 missense probably damaging 1.00
R7925:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
R8204:4933427D14Rik UTSW 11 72166780 missense probably benign 0.01
R8280:4933427D14Rik UTSW 11 72195841 missense possibly damaging 0.70
R8316:4933427D14Rik UTSW 11 72168786 missense possibly damaging 0.70
R8366:4933427D14Rik UTSW 11 72176695 nonsense probably null
R8384:4933427D14Rik UTSW 11 72166765 missense probably benign 0.08
R8722:4933427D14Rik UTSW 11 72189596 missense probably benign 0.00
X0063:4933427D14Rik UTSW 11 72176769 missense probably benign
X0065:4933427D14Rik UTSW 11 72189575 missense possibly damaging 0.65
Z1176:4933427D14Rik UTSW 11 72159000 missense probably benign 0.12
Z1186:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1186:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1186:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195710 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1187:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1187:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1188:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1188:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1189:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1189:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1190:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1190:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1191:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1191:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1192:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1192:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCGGCACTGTTTGTAGCTTC -3'
(R):5'- TGCGAGGTTACTGTGAGTTCAC -3'

Sequencing Primer
(F):5'- TCACAAACCTTAGAGACAGATGGTTG -3'
(R):5'- AATGTTGCTATATATGCATGGGATTG -3'
Posted On2016-11-09