Incidental Mutation 'BB002:4933427D14Rik'
ID642178
Institutional Source Beutler Lab
Gene Symbol 4933427D14Rik
Ensembl Gene ENSMUSG00000020807
Gene NameRIKEN cDNA 4933427D14 gene
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #BB002
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location72153929-72207459 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 72180501 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Valine at position 473 (L473V)
Ref Sequence ENSEMBL: ENSMUSP00000104146 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000108506] [ENSMUST00000131546] [ENSMUST00000142530]
Predicted Effect probably benign
Transcript: ENSMUST00000108506
AA Change: L473V

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000104146
Gene: ENSMUSG00000020807
AA Change: L473V

DomainStartEndE-ValueType
Pfam:DUF4673 1 954 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131546
AA Change: L473V

PolyPhen 2 Score 0.307 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000122273
Gene: ENSMUSG00000020807
AA Change: L473V

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
low complexity region 360 377 N/A INTRINSIC
low complexity region 545 559 N/A INTRINSIC
coiled coil region 625 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142530
SMART Domains Protein: ENSMUSP00000115276
Gene: ENSMUSG00000020807

DomainStartEndE-ValueType
low complexity region 84 93 N/A INTRINSIC
coiled coil region 210 231 N/A INTRINSIC
coiled coil region 256 279 N/A INTRINSIC
low complexity region 291 305 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433I11Rik C T 7: 40,994,082 Q392* probably null Het
A930002H24Rik A T 17: 63,863,397 V132E unknown Het
Abcc2 A G 19: 43,807,112 I436V probably benign Het
Ahr G A 12: 35,515,068 Q103* probably null Het
Asb15 T A 6: 24,562,724 H228Q probably benign Het
Asphd1 T A 7: 126,948,456 Y225F probably damaging Het
Atp2c1 A G 9: 105,442,770 M468T possibly damaging Het
BC030499 T C 11: 78,291,623 L86P probably damaging Het
Brca1 A G 11: 101,508,146 I1540T probably benign Het
Cdh20 A T 1: 104,984,748 I576F probably damaging Het
Chst11 T A 10: 83,190,954 S72T probably damaging Het
Cldn17 T G 16: 88,506,645 K65N probably damaging Het
Cldn22 T C 8: 47,825,187 I220T probably benign Het
Coasy T G 11: 101,083,696 D229E probably benign Het
Colec10 T C 15: 54,462,371 V199A probably damaging Het
Cpn2 G T 16: 30,260,801 D27E probably damaging Het
F5 T A 1: 164,176,366 probably null Het
Fat3 C T 9: 16,031,360 V1239I possibly damaging Het
Fbxl16 A G 17: 25,816,906 N159S probably benign Het
Fhad1 A G 4: 141,954,187 I514T probably damaging Het
Fras1 A G 5: 96,781,584 K3949R probably damaging Het
Gm8126 A G 14: 43,261,566 N164S probably damaging Het
Grm3 T A 5: 9,589,880 E55V probably benign Het
Itgbl1 G A 14: 123,973,323 D478N possibly damaging Het
Kcnt2 T A 1: 140,354,509 Y77* probably null Het
Kdm4c T C 4: 74,404,821 S997P probably damaging Het
Kti12 A C 4: 108,848,246 E119A probably benign Het
Kti12 G T 4: 108,848,247 E119D probably benign Het
Lrrc28 T C 7: 67,619,109 Y71C probably damaging Het
Lrrc45 T A 11: 120,715,880 W203R probably benign Het
Lrrc66 A T 5: 73,608,492 C403S possibly damaging Het
Ly6g6e A T 17: 35,077,918 E45V probably damaging Het
Mgam C T 6: 40,759,051 T1574I probably damaging Het
Msrb2 A T 2: 19,383,280 M80L probably benign Het
Musk T A 4: 58,367,513 L592Q probably damaging Het
Nlrp4a C A 7: 26,450,586 N539K probably benign Het
Obscn C G 11: 59,112,555 E1306Q probably benign Het
Olfr1006 T C 2: 85,674,563 E196G Het
Olfr1291-ps1 A G 2: 111,499,821 S190G probably damaging Het
Olfr355 A G 2: 36,927,359 F252L possibly damaging Het
Olfr388-ps1 A G 11: 73,724,536 S163P unknown Het
Opalin T A 19: 41,063,803 *144C probably null Het
Pgam2 T A 11: 5,803,007 H196L possibly damaging Het
Prrc2b A G 2: 32,204,115 E503G probably damaging Het
Prss45 T C 9: 110,841,035 L304P unknown Het
Rbm20 T A 19: 53,813,322 V87D probably damaging Het
Serpinb8 T C 1: 107,598,985 L85S probably benign Het
Sh2b2 A T 5: 136,224,261 H352Q probably benign Het
Slc6a17 T C 3: 107,495,740 I124V probably damaging Het
Smim10l1 G A 6: 133,105,582 V31M probably damaging Het
Snx10 T C 6: 51,580,321 S78P probably benign Het
Stard10 T C 7: 101,342,631 V187A probably damaging Het
Svil C A 18: 5,118,357 D2146E probably benign Het
Tsc22d4 A G 5: 137,751,365 D301G probably null Het
Ube3c T A 5: 29,646,431 I752N probably damaging Het
Wisp2 G C 2: 163,829,041 R156T possibly damaging Het
Wwc1 T C 11: 35,844,163 M962V probably benign Het
Other mutations in 4933427D14Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00707:4933427D14Rik APN 11 72178504 missense probably damaging 1.00
IGL01643:4933427D14Rik APN 11 72191588 missense probably damaging 1.00
IGL02004:4933427D14Rik APN 11 72191597 missense possibly damaging 0.62
IGL02308:4933427D14Rik APN 11 72202482 missense probably damaging 1.00
IGL02378:4933427D14Rik APN 11 72189598 missense probably benign 0.02
IGL02715:4933427D14Rik APN 11 72198888 missense probably damaging 1.00
IGL03330:4933427D14Rik APN 11 72159428 missense probably damaging 1.00
IGL03384:4933427D14Rik APN 11 72195847 missense possibly damaging 0.87
BB012:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
IGL03047:4933427D14Rik UTSW 11 72166726 missense possibly damaging 0.74
R0114:4933427D14Rik UTSW 11 72195799 missense probably damaging 1.00
R0526:4933427D14Rik UTSW 11 72169783 missense probably damaging 1.00
R0653:4933427D14Rik UTSW 11 72175545 nonsense probably null
R0669:4933427D14Rik UTSW 11 72198845 missense possibly damaging 0.73
R0729:4933427D14Rik UTSW 11 72159455 missense probably benign 0.07
R1797:4933427D14Rik UTSW 11 72198459 missense possibly damaging 0.77
R3973:4933427D14Rik UTSW 11 72198741 missense probably damaging 1.00
R4744:4933427D14Rik UTSW 11 72175539 missense probably damaging 0.98
R4897:4933427D14Rik UTSW 11 72191516 missense probably damaging 1.00
R5023:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5057:4933427D14Rik UTSW 11 72166755 missense probably benign 0.07
R5100:4933427D14Rik UTSW 11 72166651 missense probably damaging 1.00
R5497:4933427D14Rik UTSW 11 72165534 missense probably benign 0.22
R5556:4933427D14Rik UTSW 11 72175200 splice site probably null
R5631:4933427D14Rik UTSW 11 72176764 missense possibly damaging 0.71
R5683:4933427D14Rik UTSW 11 72202440 missense probably benign
R5742:4933427D14Rik UTSW 11 72165553 missense possibly damaging 0.63
R6247:4933427D14Rik UTSW 11 72158942 missense probably benign 0.02
R6267:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6296:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
R6860:4933427D14Rik UTSW 11 72189586 missense probably damaging 1.00
R7023:4933427D14Rik UTSW 11 72178403 critical splice donor site probably null
R7328:4933427D14Rik UTSW 11 72169780 critical splice donor site probably null
R7514:4933427D14Rik UTSW 11 72195802 missense probably damaging 1.00
R7544:4933427D14Rik UTSW 11 72198939 missense probably damaging 1.00
R7925:4933427D14Rik UTSW 11 72180501 missense probably benign 0.31
R8204:4933427D14Rik UTSW 11 72166780 missense probably benign 0.01
R8280:4933427D14Rik UTSW 11 72195841 missense possibly damaging 0.70
R8316:4933427D14Rik UTSW 11 72168786 missense possibly damaging 0.70
R8366:4933427D14Rik UTSW 11 72176695 nonsense probably null
R8384:4933427D14Rik UTSW 11 72166765 missense probably benign 0.08
R8722:4933427D14Rik UTSW 11 72189596 missense probably benign 0.00
X0063:4933427D14Rik UTSW 11 72176769 missense probably benign
X0065:4933427D14Rik UTSW 11 72189575 missense possibly damaging 0.65
Z1176:4933427D14Rik UTSW 11 72159000 missense probably benign 0.12
Z1186:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1186:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1186:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1186:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1186:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1186:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195710 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1187:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1187:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1187:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1187:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1187:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1188:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1188:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1188:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1188:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1188:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1189:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1189:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1189:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1189:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1189:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1190:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1190:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1190:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1190:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1190:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1191:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1191:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1191:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1191:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1191:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72176709 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72189616 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195712 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195743 missense possibly damaging 0.73
Z1192:4933427D14Rik UTSW 11 72195754 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72195764 frame shift probably null
Z1192:4933427D14Rik UTSW 11 72195769 missense probably damaging 1.00
Z1192:4933427D14Rik UTSW 11 72198482 missense probably benign 0.13
Z1192:4933427D14Rik UTSW 11 72198534 missense probably benign 0.00
Z1192:4933427D14Rik UTSW 11 72198924 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACAAAAGAAAGGATATCCATCTGC -3'
(R):5'- AGTCATTTCCCCTGTGTGGC -3'

Sequencing Primer
(F):5'- AAATGCTGGTCCTAACCCTTACTAG -3'
(R):5'- GTGGCTTACGTGGAATTTCCCC -3'
Posted On2020-08-01