Incidental Mutation 'R8209:Gm14295'
ID636049
Institutional Source Beutler Lab
Gene Symbol Gm14295
Ensembl Gene ENSMUSG00000078877
Gene Namepredicted gene 14295
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R8209 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location176798612-176811223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 176811177 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Lysine at position 820 (I820K)
Ref Sequence ENSEMBL: ENSMUSP00000119262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118012] [ENSMUST00000132883] [ENSMUST00000179435]
Predicted Effect probably benign
Transcript: ENSMUST00000118012
SMART Domains Protein: ENSMUSP00000113133
Gene: ENSMUSG00000078877

DomainStartEndE-ValueType
KRAB 4 64 5.2e-13 SMART
Predicted Effect unknown
Transcript: ENSMUST00000132883
AA Change: I820K
SMART Domains Protein: ENSMUSP00000119262
Gene: ENSMUSG00000078877
AA Change: I820K

DomainStartEndE-ValueType
KRAB 4 66 6.97e-14 SMART
ZnF_C2H2 78 97 1.61e2 SMART
ZnF_C2H2 103 125 4.17e-3 SMART
ZnF_C2H2 131 153 1.67e-2 SMART
ZnF_C2H2 159 181 2.27e-4 SMART
ZnF_C2H2 187 209 2.61e-4 SMART
ZnF_C2H2 215 237 5.5e-3 SMART
ZnF_C2H2 243 265 2.4e-3 SMART
ZnF_C2H2 271 293 6.32e-3 SMART
ZnF_C2H2 299 321 4.17e-3 SMART
ZnF_C2H2 327 349 3.21e-4 SMART
ZnF_C2H2 355 377 6.88e-4 SMART
ZnF_C2H2 383 405 9.22e-5 SMART
ZnF_C2H2 411 433 6.88e-4 SMART
ZnF_C2H2 439 461 9.22e-5 SMART
ZnF_C2H2 467 489 1.67e-2 SMART
ZnF_C2H2 495 517 3.16e-3 SMART
ZnF_C2H2 523 545 1.3e-4 SMART
ZnF_C2H2 551 573 1.67e-2 SMART
ZnF_C2H2 579 601 3.16e-3 SMART
ZnF_C2H2 607 629 6.78e-3 SMART
ZnF_C2H2 635 657 4.54e-4 SMART
ZnF_C2H2 663 685 4.54e-4 SMART
ZnF_C2H2 691 713 1.67e-2 SMART
ZnF_C2H2 719 741 3.16e-3 SMART
ZnF_C2H2 747 769 1.38e-3 SMART
ZnF_C2H2 775 797 4.94e-5 SMART
ZnF_C2H2 803 823 8.75e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179435
SMART Domains Protein: ENSMUSP00000136320
Gene: ENSMUSG00000078877

DomainStartEndE-ValueType
KRAB 3 63 5.2e-13 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Akr1b3 G C 6: 34,311,932 T114R probably damaging Het
Alx4 T C 2: 93,675,351 M266T possibly damaging Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Clec4a1 A G 6: 122,930,814 S154G probably damaging Het
Col11a2 T C 17: 34,047,279 probably null Het
Dnaaf2 A T 12: 69,198,092 V65E probably damaging Het
Dnah14 A G 1: 181,795,545 E3996G possibly damaging Het
Dsg1b A G 18: 20,408,890 Y818C probably benign Het
Dzip3 C T 16: 48,977,944 G133S probably damaging Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Eprs A G 1: 185,407,615 E967G possibly damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gart T C 16: 91,628,153 I661V possibly damaging Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
Gria2 A G 3: 80,709,457 V396A probably benign Het
Il17rc C A 6: 113,472,810 Q126K probably benign Het
Ipo8 A G 6: 148,796,678 I615T possibly damaging Het
Irak4 T A 15: 94,558,363 L277Q probably damaging Het
Islr T C 9: 58,158,057 S56G probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Phc2 T C 4: 128,709,506 L143P probably benign Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Shtn1 T C 19: 59,003,896 I417V possibly damaging Het
Slco1a5 T G 6: 142,262,682 N128H probably damaging Het
Smg5 C T 3: 88,351,531 A603V probably benign Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Timm44 A T 8: 4,266,844 M263K probably benign Het
Tmem150b A G 7: 4,720,692 L162P probably damaging Het
Tmprss11f A G 5: 86,539,707 V114A probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Tram2 A C 1: 21,005,577 Y206D probably damaging Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Tuba1b C T 15: 98,931,710 G410S probably benign Het
Vmn2r1 A G 3: 64,089,778 D285G possibly damaging Het
Zfp536 A T 7: 37,568,655 S445R probably benign Het
Zfp606 A T 7: 12,493,307 T452S probably benign Het
Other mutations in Gm14295
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1623:Gm14295 UTSW 2 176807364 missense probably damaging 1.00
R2061:Gm14295 UTSW 2 176810681 nonsense probably null
R2172:Gm14295 UTSW 2 176811102 missense possibly damaging 0.48
R2411:Gm14295 UTSW 2 176807413 missense probably benign 0.29
R4472:Gm14295 UTSW 2 176809593 missense possibly damaging 0.71
R4949:Gm14295 UTSW 2 176809676 missense probably damaging 0.99
R5082:Gm14295 UTSW 2 176807417 nonsense probably null
R5311:Gm14295 UTSW 2 176810672 missense probably benign 0.00
R5792:Gm14295 UTSW 2 176811014 missense probably benign 0.10
R6170:Gm14295 UTSW 2 176811144 unclassified probably benign
R6267:Gm14295 UTSW 2 176808989 nonsense probably null
R6286:Gm14295 UTSW 2 176809568 missense possibly damaging 0.52
R6743:Gm14295 UTSW 2 176810627 missense probably damaging 1.00
R7456:Gm14295 UTSW 2 176809150 missense possibly damaging 0.95
R7536:Gm14295 UTSW 2 176810929 missense possibly damaging 0.74
R8049:Gm14295 UTSW 2 176809078 missense probably benign 0.03
R8126:Gm14295 UTSW 2 176810865 missense probably benign 0.04
R8292:Gm14295 UTSW 2 176809558 missense probably damaging 0.99
R8356:Gm14295 UTSW 2 176809514 missense probably benign 0.24
R8412:Gm14295 UTSW 2 176809629 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTAAAACCTTTGCAGAAAGCAGTAC -3'
(R):5'- TCACTCCTTCCTGCAAAGAC -3'

Sequencing Primer
(F):5'- GCAGAAAGCAGTACTCTCCAAATC -3'
(R):5'- TCCTGCAAAGACTTTACCACATTGG -3'
Posted On2020-07-13