Incidental Mutation 'R8209:Dnah14'
ID636038
Institutional Source Beutler Lab
Gene Symbol Dnah14
Ensembl Gene ENSMUSG00000047369
Gene Namedynein, axonemal, heavy chain 14
SynonymsDnahc14, Gm980, LOC381311, A230079K17Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R8209 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location181576559-181815774 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 181795545 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 3996 (E3996G)
Ref Sequence ENSEMBL: ENSMUSP00000146843 (fasta)
Predicted Effect possibly damaging
Transcript: ENSMUST00000208001
AA Change: E3996G

PolyPhen 2 Score 0.688 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Dyneins are microtubule-associated motor protein complexes composed of several heavy, light, and intermediate chains. Two major classes of dyneins, axonemal and cytoplasmic, have been identified. DNAH14 is an axonemal dynein heavy chain (DHC) (Vaughan et al., 1996 [PubMed 8812413]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9330159F19Rik A G 10: 29,218,199 N27S probably damaging Het
Akr1b3 G C 6: 34,311,932 T114R probably damaging Het
Alx4 T C 2: 93,675,351 M266T possibly damaging Het
Arhgap21 C T 2: 20,871,745 D820N probably damaging Het
Clec4a1 A G 6: 122,930,814 S154G probably damaging Het
Col11a2 T C 17: 34,047,279 probably null Het
Dnaaf2 A T 12: 69,198,092 V65E probably damaging Het
Dsg1b A G 18: 20,408,890 Y818C probably benign Het
Dzip3 C T 16: 48,977,944 G133S probably damaging Het
Efcab6 T C 15: 83,904,255 Y946C probably benign Het
Eprs A G 1: 185,407,615 E967G possibly damaging Het
F5 T C 1: 164,194,390 V1478A probably benign Het
Fchsd2 C T 7: 101,282,472 P745L probably damaging Het
Gart T C 16: 91,628,153 I661V possibly damaging Het
Gm14295 T A 2: 176,811,177 I820K unknown Het
Gm9573 T C 17: 35,619,707 probably benign Het
Grb10 G T 11: 11,951,533 L214M probably damaging Het
Gria2 A G 3: 80,709,457 V396A probably benign Het
Il17rc C A 6: 113,472,810 Q126K probably benign Het
Ipo8 A G 6: 148,796,678 I615T possibly damaging Het
Irak4 T A 15: 94,558,363 L277Q probably damaging Het
Islr T C 9: 58,158,057 S56G probably damaging Het
Krt78 A T 15: 101,947,045 M777K possibly damaging Het
Lrch4 A G 5: 137,639,735 H93R Het
Nbeal1 A T 1: 60,277,177 K1846N probably damaging Het
Nedd1 T A 10: 92,691,935 M466L probably benign Het
Nup107 T C 10: 117,757,931 K786E probably benign Het
Olfr1024 T C 2: 85,904,203 I284V probably benign Het
Olfr560 T C 7: 102,753,743 Y62C probably benign Het
Olfr995 T A 2: 85,438,637 I174F probably damaging Het
Phc2 T C 4: 128,709,506 L143P probably benign Het
Pkhd1l1 A G 15: 44,574,407 N3533D possibly damaging Het
Plpp1 A T 13: 112,866,931 T230S probably benign Het
Prokr2 C A 2: 132,374,041 A167S probably damaging Het
Qser1 C T 2: 104,788,725 A491T probably benign Het
Rc3h2 T A 2: 37,376,989 Y1040F possibly damaging Het
Rgl2 C T 17: 33,932,527 L182F possibly damaging Het
Rnf130 T C 11: 50,071,270 V181A probably benign Het
Scn7a T G 2: 66,700,860 I558L possibly damaging Het
Shtn1 T C 19: 59,003,896 I417V possibly damaging Het
Slco1a5 T G 6: 142,262,682 N128H probably damaging Het
Smg5 C T 3: 88,351,531 A603V probably benign Het
Svs3b T A 2: 164,256,220 E60D possibly damaging Het
Thap1 CAGCATCTGCTCGGAGCA CAGCA 8: 26,160,856 probably null Het
Timm44 A T 8: 4,266,844 M263K probably benign Het
Tmem150b A G 7: 4,720,692 L162P probably damaging Het
Tmprss11f A G 5: 86,539,707 V114A probably damaging Het
Trak1 C T 9: 121,451,727 T394I probably benign Het
Tram2 A C 1: 21,005,577 Y206D probably damaging Het
Trhde C T 10: 114,567,228 V497M probably damaging Het
Trpc2 A G 7: 102,088,275 M425V possibly damaging Het
Tuba1b C T 15: 98,931,710 G410S probably benign Het
Vmn2r1 A G 3: 64,089,778 D285G possibly damaging Het
Zfp536 A T 7: 37,568,655 S445R probably benign Het
Zfp606 A T 7: 12,493,307 T452S probably benign Het
Other mutations in Dnah14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01086:Dnah14 APN 1 181752046 missense probably benign 0.17
IGL01764:Dnah14 APN 1 181744777 missense probably benign 0.00
IGL03218:Dnah14 APN 1 181755269 missense probably benign 0.02
IGL03290:Dnah14 APN 1 181763978 splice site probably benign
IGL03384:Dnah14 APN 1 181745949 missense probably benign 0.03
R0009:Dnah14 UTSW 1 181769407 splice site probably benign
R0125:Dnah14 UTSW 1 181752063 missense probably damaging 0.99
R0579:Dnah14 UTSW 1 181744747 missense possibly damaging 0.72
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0973:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R0974:Dnah14 UTSW 1 181752145 missense probably damaging 1.00
R1609:Dnah14 UTSW 1 181750177 missense probably damaging 0.97
R1860:Dnah14 UTSW 1 181763960 missense probably damaging 1.00
R2050:Dnah14 UTSW 1 181752562 missense probably damaging 1.00
R2974:Dnah14 UTSW 1 181755241 critical splice acceptor site probably null
R4715:Dnah14 UTSW 1 181757223 missense probably damaging 1.00
R5076:Dnah14 UTSW 1 181757234 missense probably benign 0.01
R5424:Dnah14 UTSW 1 181763310 missense possibly damaging 0.95
R5808:Dnah14 UTSW 1 181741159 missense possibly damaging 0.72
R5997:Dnah14 UTSW 1 181770105 missense probably benign 0.00
R6052:Dnah14 UTSW 1 181666487 missense possibly damaging 0.50
R6061:Dnah14 UTSW 1 181709051 missense probably damaging 1.00
R6089:Dnah14 UTSW 1 181750154 missense probably damaging 1.00
R6092:Dnah14 UTSW 1 181621833 missense probably benign 0.13
R6145:Dnah14 UTSW 1 181666417 missense probably benign 0.00
R6163:Dnah14 UTSW 1 181666361 missense probably benign 0.33
R6246:Dnah14 UTSW 1 181680888 missense probably benign 0.00
R6302:Dnah14 UTSW 1 181601206 missense possibly damaging 0.96
R6306:Dnah14 UTSW 1 181585024 frame shift probably null
R6326:Dnah14 UTSW 1 181783556 missense probably damaging 1.00
R6348:Dnah14 UTSW 1 181626720 missense possibly damaging 0.83
R6367:Dnah14 UTSW 1 181755386 splice site probably null
R6376:Dnah14 UTSW 1 181605894 missense possibly damaging 0.79
R6389:Dnah14 UTSW 1 181651202 critical splice donor site probably null
R6433:Dnah14 UTSW 1 181651657 missense probably damaging 0.99
R6454:Dnah14 UTSW 1 181783705 missense probably damaging 1.00
R6476:Dnah14 UTSW 1 181744768 missense probably benign 0.26
R6523:Dnah14 UTSW 1 181643621 missense probably benign 0.00
R6529:Dnah14 UTSW 1 181666469 missense probably damaging 0.98
R6538:Dnah14 UTSW 1 181584985 missense unknown
R6546:Dnah14 UTSW 1 181738987 missense probably damaging 1.00
R6752:Dnah14 UTSW 1 181593452 missense probably benign 0.07
R6762:Dnah14 UTSW 1 181757259 missense probably damaging 1.00
R6786:Dnah14 UTSW 1 181641405 missense probably benign 0.21
R6849:Dnah14 UTSW 1 181808945 missense probably benign 0.00
R6877:Dnah14 UTSW 1 181628432 missense possibly damaging 0.82
R6912:Dnah14 UTSW 1 181750183 missense possibly damaging 0.83
R6919:Dnah14 UTSW 1 181585066 missense probably benign 0.04
R6924:Dnah14 UTSW 1 181627952 missense probably benign 0.04
R6957:Dnah14 UTSW 1 181785175 missense possibly damaging 0.92
R6980:Dnah14 UTSW 1 181648230 missense probably benign 0.00
R7018:Dnah14 UTSW 1 181626944 missense possibly damaging 0.55
R7046:Dnah14 UTSW 1 181623003 missense probably benign 0.01
R7058:Dnah14 UTSW 1 181698049 missense probably benign 0.00
R7068:Dnah14 UTSW 1 181769790 missense probably benign 0.35
R7115:Dnah14 UTSW 1 181720145 missense probably damaging 1.00
R7130:Dnah14 UTSW 1 181745958 nonsense probably null
R7165:Dnah14 UTSW 1 181704535 missense probably benign 0.00
R7169:Dnah14 UTSW 1 181702365 missense probably benign 0.00
R7184:Dnah14 UTSW 1 181704529 nonsense probably null
R7232:Dnah14 UTSW 1 181757363 missense probably damaging 1.00
R7260:Dnah14 UTSW 1 181706744 missense probably damaging 0.99
R7276:Dnah14 UTSW 1 181685807 missense probably benign 0.41
R7290:Dnah14 UTSW 1 181628174 missense probably benign 0.20
R7314:Dnah14 UTSW 1 181785254 splice site probably null
R7326:Dnah14 UTSW 1 181598403 missense probably benign 0.02
R7336:Dnah14 UTSW 1 181797734 missense probably damaging 0.96
R7363:Dnah14 UTSW 1 181690524 splice site probably null
R7371:Dnah14 UTSW 1 181626885 missense probably benign 0.05
R7376:Dnah14 UTSW 1 181763402 missense probably benign 0.03
R7418:Dnah14 UTSW 1 181616742 missense possibly damaging 0.92
R7473:Dnah14 UTSW 1 181752139 missense probably damaging 0.99
R7514:Dnah14 UTSW 1 181628067 missense probably damaging 0.96
R7555:Dnah14 UTSW 1 181770054 missense probably benign 0.26
R7641:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7663:Dnah14 UTSW 1 181752155 splice site probably null
R7674:Dnah14 UTSW 1 181707533 missense probably benign 0.01
R7680:Dnah14 UTSW 1 181685800 missense probably benign 0.15
R7709:Dnah14 UTSW 1 181702484 critical splice donor site probably null
R7842:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
R7861:Dnah14 UTSW 1 181616759 missense probably damaging 1.00
R7988:Dnah14 UTSW 1 181783574 missense probably damaging 0.97
R8016:Dnah14 UTSW 1 181648311 missense probably benign 0.05
R8042:Dnah14 UTSW 1 181643631 critical splice donor site probably null
R8071:Dnah14 UTSW 1 181615894 missense possibly damaging 0.84
R8086:Dnah14 UTSW 1 181766232 missense probably damaging 1.00
R8095:Dnah14 UTSW 1 181806032 nonsense probably null
R8139:Dnah14 UTSW 1 181755288 missense probably damaging 1.00
R8176:Dnah14 UTSW 1 181657033 missense probably damaging 0.96
R8193:Dnah14 UTSW 1 181688205 missense probably damaging 1.00
R8197:Dnah14 UTSW 1 181690101 missense possibly damaging 0.94
R8226:Dnah14 UTSW 1 181795545 missense possibly damaging 0.69
R8251:Dnah14 UTSW 1 181664865 missense probably damaging 1.00
R8264:Dnah14 UTSW 1 181744792 missense probably damaging 0.99
R8284:Dnah14 UTSW 1 181773811 missense probably benign 0.03
R8289:Dnah14 UTSW 1 181716215 nonsense probably null
R8323:Dnah14 UTSW 1 181704544 missense probably benign 0.01
R8442:Dnah14 UTSW 1 181741284 missense probably damaging 0.97
R8458:Dnah14 UTSW 1 181806012 missense
R8507:Dnah14 UTSW 1 181641414 missense probably benign 0.02
R8509:Dnah14 UTSW 1 181814655 missense
RF007:Dnah14 UTSW 1 181685809 missense probably benign 0.00
RF012:Dnah14 UTSW 1 181627898 missense probably damaging 0.99
Z1176:Dnah14 UTSW 1 181757351 missense possibly damaging 0.83
Z1177:Dnah14 UTSW 1 181690320 missense probably benign 0.03
Z1177:Dnah14 UTSW 1 181763334 missense probably damaging 1.00
Z1177:Dnah14 UTSW 1 181766304 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCATTGCCCATGTCTGTG -3'
(R):5'- GAGACACTCATTTCTTACCTCATTG -3'

Sequencing Primer
(F):5'- GCCTGAATTGGCCTTGAAC -3'
(R):5'- CCTCATTGCTAGAGAAACTGTAGTC -3'
Posted On2020-07-13