Incidental Mutation 'R8274:Gbp4'
ID637888
Institutional Source Beutler Lab
Gene Symbol Gbp4
Ensembl Gene ENSMUSG00000079363
Gene Nameguanylate binding protein 4
SynonymsMpa2, Mag-2, Mpa-2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R8274 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location105115767-105139586 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 105119472 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 527 (N527S)
Ref Sequence ENSEMBL: ENSMUSP00000098522 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031235] [ENSMUST00000100961] [ENSMUST00000100962] [ENSMUST00000196204] [ENSMUST00000196677] [ENSMUST00000199629]
Predicted Effect probably benign
Transcript: ENSMUST00000031235
SMART Domains Protein: ENSMUSP00000031235
Gene: ENSMUSG00000034438

DomainStartEndE-ValueType
Pfam:GBP 16 213 5.4e-91 PFAM
Pfam:GBP_C 206 493 1e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100961
SMART Domains Protein: ENSMUSP00000098521
Gene: ENSMUSG00000029298

DomainStartEndE-ValueType
Pfam:GBP 16 279 3.8e-124 PFAM
Pfam:GBP_C 281 575 4.5e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100962
AA Change: N527S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000098522
Gene: ENSMUSG00000079363
AA Change: N527S

DomainStartEndE-ValueType
Pfam:GBP 16 287 4.2e-91 PFAM
Pfam:GBP_C 289 583 4.4e-117 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196204
SMART Domains Protein: ENSMUSP00000142528
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 16 76 1e-19 PFAM
low complexity region 82 103 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000196677
SMART Domains Protein: ENSMUSP00000142795
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 149 3e-56 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000199629
SMART Domains Protein: ENSMUSP00000143689
Gene: ENSMUSG00000079363

DomainStartEndE-ValueType
Pfam:GBP 1 127 1.5e-43 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921536K21Rik T C 11: 3,894,964 T42A possibly damaging Het
Adamts6 T C 13: 104,313,673 V294A probably benign Het
Ahr A C 12: 35,510,069 V195G probably benign Het
Ankrd17 A T 5: 90,282,859 I1022N probably benign Het
Arsk A T 13: 76,072,184 C264S probably damaging Het
Astn2 A G 4: 65,651,861 probably null Het
Atf7ip C A 6: 136,560,990 T407K probably benign Het
Axl A G 7: 25,764,013 I613T probably damaging Het
Baz2a T C 10: 128,121,847 M1021T probably benign Het
Cacna2d2 T C 9: 107,524,662 V765A possibly damaging Het
Chd7 T C 4: 8,839,432 Y1323H probably damaging Het
Col7a1 G T 9: 108,969,961 G1794V probably damaging Het
Csmd1 T C 8: 15,910,453 M3321V possibly damaging Het
Dcp1b T C 6: 119,183,651 S65P probably damaging Het
Depdc7 A G 2: 104,728,206 S157P probably benign Het
Dnah1 T A 14: 31,295,574 H1500L probably benign Het
Erbb2 C T 11: 98,433,896 A772V probably damaging Het
Fan1 T A 7: 64,372,486 N340Y probably damaging Het
Fat3 T A 9: 16,377,490 K246* probably null Het
Gpr157 C T 4: 150,088,043 T97M probably damaging Het
Gpt2 T C 8: 85,516,224 L295P probably benign Het
Grm8 T A 6: 27,761,336 K296N probably benign Het
Gss T A 2: 155,587,504 I23L probably benign Het
Hk3 A G 13: 55,011,417 V442A possibly damaging Het
Hoxa3 C A 6: 52,170,544 R243L unknown Het
Junb T A 8: 84,978,429 M1L possibly damaging Het
Kcnh6 T C 11: 106,020,161 I514T probably damaging Het
Kif11 C A 19: 37,403,546 T463N probably damaging Het
Lmf2 C T 15: 89,352,663 G459S probably damaging Het
Lpl A G 8: 68,892,598 T85A possibly damaging Het
Lrrc29 T A 8: 105,315,534 I221F probably benign Het
Myo9b G A 8: 71,359,836 A2084T probably benign Het
Olfr830 T A 9: 18,875,499 H57Q probably benign Het
Polr2a G A 11: 69,748,056 R51C probably damaging Het
Ppip5k2 A G 1: 97,759,216 V94A possibly damaging Het
Ptprk G T 10: 28,580,412 R1056L probably damaging Het
Rfx2 C T 17: 56,804,348 A75T probably benign Het
Scn11a T C 9: 119,803,482 T441A probably benign Het
Siglec1 A G 2: 131,083,910 V292A probably benign Het
Smok2a G A 17: 13,226,894 A453T probably benign Het
Tmcc3 T C 10: 94,586,876 V427A probably damaging Het
Tmem208 T G 8: 105,328,625 I106S probably damaging Het
Trav9-2 G T 14: 53,591,353 R60L probably benign Het
Vcan T C 13: 89,704,970 K624E probably benign Het
Zfp318 A T 17: 46,412,989 M1973L probably benign Het
Other mutations in Gbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01307:Gbp4 APN 5 105137021 start codon destroyed probably null 0.00
IGL01834:Gbp4 APN 5 105125602 missense probably damaging 1.00
IGL02100:Gbp4 APN 5 105122075 unclassified probably benign
IGL02119:Gbp4 APN 5 105121042 missense probably benign 0.14
IGL02364:Gbp4 APN 5 105136874 missense probably damaging 1.00
IGL03026:Gbp4 APN 5 105120000 missense possibly damaging 0.88
PIT4651001:Gbp4 UTSW 5 105118423 missense probably benign 0.08
R0147:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0148:Gbp4 UTSW 5 105119496 missense probably benign 0.17
R0413:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0415:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
R0478:Gbp4 UTSW 5 105119433 missense probably benign 0.01
R0546:Gbp4 UTSW 5 105120970 missense probably damaging 1.00
R0638:Gbp4 UTSW 5 105121840 missense probably damaging 0.98
R1528:Gbp4 UTSW 5 105121792 splice site probably null
R1541:Gbp4 UTSW 5 105118409 missense probably benign
R2099:Gbp4 UTSW 5 105121081 missense probably damaging 1.00
R2112:Gbp4 UTSW 5 105135176 missense possibly damaging 0.95
R2994:Gbp4 UTSW 5 105137020 start codon destroyed probably null 0.86
R4021:Gbp4 UTSW 5 105120923 missense probably damaging 0.96
R4258:Gbp4 UTSW 5 105136975 missense probably damaging 1.00
R4489:Gbp4 UTSW 5 105121907 missense probably damaging 1.00
R5164:Gbp4 UTSW 5 105136877 nonsense probably null
R5195:Gbp4 UTSW 5 105119532 missense probably benign 0.00
R5406:Gbp4 UTSW 5 105119521 missense possibly damaging 0.76
R5550:Gbp4 UTSW 5 105122045 missense probably damaging 1.00
R5701:Gbp4 UTSW 5 105118399 missense possibly damaging 0.60
R5814:Gbp4 UTSW 5 105119919 missense probably benign 0.27
R6128:Gbp4 UTSW 5 105135164 missense possibly damaging 0.93
R6307:Gbp4 UTSW 5 105123109 nonsense probably null
R6513:Gbp4 UTSW 5 105123120 missense possibly damaging 0.69
R6870:Gbp4 UTSW 5 105125578 missense probably damaging 1.00
R6938:Gbp4 UTSW 5 105135077 missense probably damaging 0.99
R7063:Gbp4 UTSW 5 105118448 missense probably damaging 0.96
R7124:Gbp4 UTSW 5 105119959 missense possibly damaging 0.45
R7457:Gbp4 UTSW 5 105119553 missense probably damaging 0.98
R7615:Gbp4 UTSW 5 105122982 missense possibly damaging 0.95
R7877:Gbp4 UTSW 5 105118295 missense probably benign 0.34
R7905:Gbp4 UTSW 5 105121087 missense probably damaging 1.00
R8377:Gbp4 UTSW 5 105118462 missense probably benign 0.02
R8414:Gbp4 UTSW 5 105136837 missense probably benign 0.05
R8423:Gbp4 UTSW 5 105119934 missense probably damaging 1.00
S24628:Gbp4 UTSW 5 105121106 missense possibly damaging 0.85
X0067:Gbp4 UTSW 5 105125625 missense probably damaging 0.98
Z1088:Gbp4 UTSW 5 105120997 missense probably damaging 1.00
Z1177:Gbp4 UTSW 5 105119449 nonsense probably null
Z1177:Gbp4 UTSW 5 105125135 missense probably null 0.89
Predicted Primers PCR Primer
(F):5'- CCCATGACCTGGCTGAATAC -3'
(R):5'- AGAAACATGCTCCCCAAGTGTG -3'

Sequencing Primer
(F):5'- GAATACTTTCTCCCACTGCCTGGAG -3'
(R):5'- ATGCTCCTTTTCAGATTTGAATTGC -3'
Posted On2020-07-28