Mutagenetix > Incidental Mutation

Incidental Mutation 'BB008:Lrrc3b'

642486

Institutional Source

Beutler Lab

Gene Symbol

Lrrc3b

Ensembl Gene

ENSMUSG00000045201

Gene Name

leucine rich repeat containing 3B

Synonyms

LRP15

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

BB008

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

7030776-7112248 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 15358018 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 196 (N196S)

Ref Sequence

ENSEMBL: ENSMUSP00000059463 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055211] [ENSMUST00000163937] [ENSMUST00000223700]

AlphaFold

Q8VCH9

Predicted Effect

probably benign
Transcript: ENSMUST00000055211
AA Change: N196S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000059463
Gene: ENSMUSG00000045201
AA Change: N196S

Domain	Start	End	E-Value	Type
LRRNT	33	68	1.85e-8	SMART
LRR	67	86	3e1	SMART
LRR_TYP	87	110	8.94e-3	SMART
LRR	115	135	3.86e0	SMART
Blast:LRRCT	145	196	2e-8	BLAST
transmembrane domain	203	225	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000163937
AA Change: N196S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000128624
Gene: ENSMUSG00000045201
AA Change: N196S

Domain	Start	End	E-Value	Type
LRRNT	33	68	1.85e-8	SMART
LRR	67	86	3e1	SMART
LRR_TYP	87	110	8.94e-3	SMART
LRR	115	135	3.86e0	SMART
Blast:LRRCT	145	196	2e-8	BLAST
transmembrane domain	203	225	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000223700
AA Change: N196S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor, with lowered expression levels found in gastric, renal, colorectal, lung, and breast cancer tissues. The promoter of this gene is frequently hypermethylated in these cancer tissues, although the hypermethylation does not appear to be the cause of the reduced expression of this gene. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal olfactory epithelium and bulb. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acp2	A	T	2: 91,037,060 (GRCm39)		probably null	Het
Aire	G	A	10: 77,866,130 (GRCm39)	A536V	probably damaging	Het
Aox4	A	G	1: 58,294,645 (GRCm39)	I951M	probably benign	Het
Ash1l	G	T	3: 88,950,848 (GRCm39)	C2190F	probably damaging	Het
C1s1	C	T	6: 124,510,359 (GRCm39)	V363M	probably damaging	Het
Diaph3	A	T	14: 87,352,456 (GRCm39)	D48E	possibly damaging	Het
Dnajc13	A	G	9: 104,095,763 (GRCm39)	V559A	probably benign	Het
Dzank1	T	C	2: 144,323,614 (GRCm39)	I610V	probably benign	Het
F7	A	G	8: 13,085,209 (GRCm39)	I412V	probably benign	Het
Flt1	A	G	5: 147,525,382 (GRCm39)	S919P	probably damaging	Het
Igkv4-70	C	A	6: 69,244,975 (GRCm39)	R82L	probably damaging	Het
Lnp1	T	A	16: 56,748,281 (GRCm39)	R4*	probably null	Het
Mlxip	A	G	5: 123,588,558 (GRCm39)	D816G	probably damaging	Het
Myh7	C	T	14: 55,221,119 (GRCm39)	E935K	possibly damaging	Het
Myom3	A	T	4: 135,516,947 (GRCm39)	H839L	probably benign	Het
Nebl	C	T	2: 17,381,433 (GRCm39)		probably null	Het
Ninj1	T	C	13: 49,347,432 (GRCm39)	I99T	probably damaging	Het
Or11g1	A	C	14: 50,651,786 (GRCm39)	M262L	probably damaging	Het
Or2l5	A	G	16: 19,334,258 (GRCm39)	S43P	possibly damaging	Het
Or4a76	T	A	2: 89,460,448 (GRCm39)	I265F	possibly damaging	Het
Or8g55	A	T	9: 39,785,146 (GRCm39)	T192S	possibly damaging	Het
Otop1	A	G	5: 38,445,364 (GRCm39)	H174R	probably damaging	Het
Pcdhb16	A	G	18: 37,611,510 (GRCm39)	N157D	possibly damaging	Het
Prss44	A	C	9: 110,643,746 (GRCm39)	Q130P	probably damaging	Het
Ptpn4	T	A	1: 119,607,925 (GRCm39)	M712L	probably damaging	Het
Ptprh	C	A	7: 4,574,987 (GRCm39)	S344I	probably benign	Het
Rps6kl1	T	C	12: 85,196,566 (GRCm39)	I33V	possibly damaging	Het
Scn1a	T	C	2: 66,148,156 (GRCm39)	S110G	probably damaging	Het
Sdk2	C	A	11: 113,784,267 (GRCm39)	K157N	possibly damaging	Het
Serpina1d	A	T	12: 103,733,815 (GRCm39)	V163D	probably damaging	Het
Serpina3g	T	C	12: 104,205,428 (GRCm39)	S56P	probably benign	Het
Slc4a4	T	C	5: 89,318,640 (GRCm39)	L636P	probably benign	Het
Slc6a1	T	C	6: 114,288,863 (GRCm39)	F474S	probably benign	Het
Slco6d1	A	G	1: 98,356,141 (GRCm39)	D235G	probably damaging	Het
Srgn	A	T	10: 62,330,763 (GRCm39)	M114K	possibly damaging	Het
Syne3	A	T	12: 104,929,491 (GRCm39)	V243E	probably damaging	Het
Tcf19	A	G	17: 35,825,804 (GRCm39)	F118L	probably damaging	Het
Tln2	A	T	9: 67,165,742 (GRCm39)		probably null	Het
Tnxb	A	G	17: 34,907,672 (GRCm39)	T1239A	probably damaging	Het
Traip	A	G	9: 107,848,241 (GRCm39)	I453M	probably benign	Het
Vmn1r157	C	T	7: 22,461,210 (GRCm39)	A30V	probably damaging	Het
Vmn1r233	G	A	17: 21,214,125 (GRCm39)	A275V	probably benign	Het
Vps13d	G	A	4: 144,822,854 (GRCm39)	R2976*	probably null	Het
Wdr75	T	C	1: 45,858,795 (GRCm39)	F655L	probably benign	Het
Wwp1	A	G	4: 19,650,114 (GRCm39)		probably null	Het
Zc3h4	T	C	7: 16,166,909 (GRCm39)	L747P	unknown	Het
Zfp268	G	A	4: 145,349,126 (GRCm39)	D188N	possibly damaging	Het

Other mutations in Lrrc3b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01761:Lrrc3b	APN	14	15,358,098 (GRCm38)	missense	probably benign	0.00
IGL03141:Lrrc3b	APN	14	15,358,390 (GRCm38)	missense	probably damaging	1.00
Klutz	UTSW	14	15,357,946 (GRCm38)	missense	probably damaging	1.00
BB018:Lrrc3b	UTSW	14	15,358,018 (GRCm38)	missense	probably benign	0.36
PIT4810001:Lrrc3b	UTSW	14	15,358,273 (GRCm38)	missense	probably benign	0.17
R0371:Lrrc3b	UTSW	14	15,358,560 (GRCm38)	nonsense	probably null
R1750:Lrrc3b	UTSW	14	15,358,601 (GRCm38)	missense	probably benign	0.00
R2280:Lrrc3b	UTSW	14	15,358,076 (GRCm38)	missense	probably damaging	0.99
R4663:Lrrc3b	UTSW	14	15,358,220 (GRCm38)	missense	probably benign	0.01
R4929:Lrrc3b	UTSW	14	15,357,888 (GRCm38)	missense	probably damaging	1.00
R5344:Lrrc3b	UTSW	14	15,358,591 (GRCm38)	missense	probably damaging	1.00
R6537:Lrrc3b	UTSW	14	15,357,946 (GRCm38)	missense	probably damaging	1.00
R7301:Lrrc3b	UTSW	14	15,357,934 (GRCm38)	missense	probably damaging	1.00
R7931:Lrrc3b	UTSW	14	15,358,018 (GRCm38)	missense	probably benign	0.36
R8113:Lrrc3b	UTSW	14	15,358,232 (GRCm38)	missense	probably benign	0.01
R8220:Lrrc3b	UTSW	14	15,358,004 (GRCm38)	missense	probably damaging	1.00
R8834:Lrrc3b	UTSW	14	15,358,562 (GRCm38)	missense	possibly damaging	0.95
R8955:Lrrc3b	UTSW	14	15,358,159 (GRCm38)	missense	probably damaging	1.00
R9445:Lrrc3b	UTSW	14	15,358,552 (GRCm38)	missense	probably damaging	1.00
R9522:Lrrc3b	UTSW	14	15,358,423 (GRCm38)	missense	probably benign	0.15

Predicted Primers

PCR Primer
(F):5'- TAATGTCATCAGGCTCATCTGC -3'
(R):5'- ACAACAGGATTCAAAGTGTGCAC -3'

Sequencing Primer
(F):5'- GCCTTCTTTTGCCTGCTTGG -3'
(R):5'- CTTCAATAATCTGAAGGCTAGGGC -3'

Posted On

2020-08-01