Incidental Mutation 'BB008:Lrrc3b'
ID642486
Institutional Source Beutler Lab
Gene Symbol Lrrc3b
Ensembl Gene ENSMUSG00000045201
Gene Nameleucine rich repeat containing 3B
SynonymsLRP15
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #BB008
Quality Score225.009
Status Not validated
Chromosome14
Chromosomal Location15357515-15438987 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 15358018 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 196 (N196S)
Ref Sequence ENSEMBL: ENSMUSP00000059463 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055211] [ENSMUST00000163937] [ENSMUST00000223700]
Predicted Effect probably benign
Transcript: ENSMUST00000055211
AA Change: N196S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000059463
Gene: ENSMUSG00000045201
AA Change: N196S

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163937
AA Change: N196S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128624
Gene: ENSMUSG00000045201
AA Change: N196S

DomainStartEndE-ValueType
LRRNT 33 68 1.85e-8 SMART
LRR 67 86 3e1 SMART
LRR_TYP 87 110 8.94e-3 SMART
LRR 115 135 3.86e0 SMART
Blast:LRRCT 145 196 2e-8 BLAST
transmembrane domain 203 225 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223700
AA Change: N196S

PolyPhen 2 Score 0.358 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a tumor suppressor, with lowered expression levels found in gastric, renal, colorectal, lung, and breast cancer tissues. The promoter of this gene is frequently hypermethylated in these cancer tissues, although the hypermethylation does not appear to be the cause of the reduced expression of this gene. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal olfactory epithelium and bulb. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acp2 A T 2: 91,206,715 probably null Het
Aire G A 10: 78,030,296 A536V probably damaging Het
Aox4 A G 1: 58,255,486 I951M probably benign Het
Ash1l G T 3: 89,043,541 C2190F probably damaging Het
C1s1 C T 6: 124,533,400 V363M probably damaging Het
Diaph3 A T 14: 87,115,020 D48E possibly damaging Het
Dnajc13 A G 9: 104,218,564 V559A probably benign Het
Dzank1 T C 2: 144,481,694 I610V probably benign Het
F7 A G 8: 13,035,209 I412V probably benign Het
Flt1 A G 5: 147,588,572 S919P probably damaging Het
Gm13212 G A 4: 145,622,556 D188N possibly damaging Het
Igkv4-70 C A 6: 69,267,991 R82L probably damaging Het
Lnp1 T A 16: 56,927,918 R4* probably null Het
Mlxip A G 5: 123,450,495 D816G probably damaging Het
Myh7 C T 14: 54,983,662 E935K possibly damaging Het
Myom3 A T 4: 135,789,636 H839L probably benign Het
Nebl C T 2: 17,376,622 probably null Het
Ninj1 T C 13: 49,193,956 I99T probably damaging Het
Olfr1249 T A 2: 89,630,104 I265F possibly damaging Het
Olfr167 A G 16: 19,515,508 S43P possibly damaging Het
Olfr738 A C 14: 50,414,329 M262L probably damaging Het
Olfr972 A T 9: 39,873,850 T192S possibly damaging Het
Otop1 A G 5: 38,288,020 H174R probably damaging Het
Pcdhb16 A G 18: 37,478,457 N157D possibly damaging Het
Prss44 A C 9: 110,814,678 Q130P probably damaging Het
Ptpn4 T A 1: 119,680,195 M712L probably damaging Het
Ptprh C A 7: 4,571,988 S344I probably benign Het
Rps6kl1 T C 12: 85,149,792 I33V possibly damaging Het
Scn1a T C 2: 66,317,812 S110G probably damaging Het
Sdk2 C A 11: 113,893,441 K157N possibly damaging Het
Serpina1d A T 12: 103,767,556 V163D probably damaging Het
Serpina3g T C 12: 104,239,169 S56P probably benign Het
Slc4a4 T C 5: 89,170,781 L636P probably benign Het
Slc6a1 T C 6: 114,311,902 F474S probably benign Het
Slco6d1 A G 1: 98,428,416 D235G probably damaging Het
Srgn A T 10: 62,494,984 M114K possibly damaging Het
Syne3 A T 12: 104,963,232 V243E probably damaging Het
Tcf19 A G 17: 35,514,907 F118L probably damaging Het
Tln2 A T 9: 67,258,460 probably null Het
Tnxb A G 17: 34,688,698 T1239A probably damaging Het
Traip A G 9: 107,971,042 I453M probably benign Het
Vmn1r157 C T 7: 22,761,785 A30V probably damaging Het
Vmn1r233 G A 17: 20,993,863 A275V probably benign Het
Vps13d G A 4: 145,096,284 R2976* probably null Het
Wdr75 T C 1: 45,819,635 F655L probably benign Het
Wwp1 A G 4: 19,650,114 probably null Het
Zc3h4 T C 7: 16,432,984 L747P unknown Het
Other mutations in Lrrc3b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01761:Lrrc3b APN 14 15358098 missense probably benign 0.00
IGL03141:Lrrc3b APN 14 15358390 missense probably damaging 1.00
Klutz UTSW 14 15357946 missense probably damaging 1.00
BB018:Lrrc3b UTSW 14 15358018 missense probably benign 0.36
PIT4810001:Lrrc3b UTSW 14 15358273 missense probably benign 0.17
R0371:Lrrc3b UTSW 14 15358560 nonsense probably null
R1750:Lrrc3b UTSW 14 15358601 missense probably benign 0.00
R2280:Lrrc3b UTSW 14 15358076 missense probably damaging 0.99
R4663:Lrrc3b UTSW 14 15358220 missense probably benign 0.01
R4929:Lrrc3b UTSW 14 15357888 missense probably damaging 1.00
R5344:Lrrc3b UTSW 14 15358591 missense probably damaging 1.00
R6537:Lrrc3b UTSW 14 15357946 missense probably damaging 1.00
R7301:Lrrc3b UTSW 14 15357934 missense probably damaging 1.00
R7931:Lrrc3b UTSW 14 15358018 missense probably benign 0.36
R8113:Lrrc3b UTSW 14 15358232 missense probably benign 0.01
R8220:Lrrc3b UTSW 14 15358004 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAATGTCATCAGGCTCATCTGC -3'
(R):5'- ACAACAGGATTCAAAGTGTGCAC -3'

Sequencing Primer
(F):5'- GCCTTCTTTTGCCTGCTTGG -3'
(R):5'- CTTCAATAATCTGAAGGCTAGGGC -3'
Posted On2020-08-01