Incidental Mutation 'R8380:Vill'
ID 646914
Institutional Source Beutler Lab
Gene Symbol Vill
Ensembl Gene ENSMUSG00000038775
Gene Name villin-like
Synonyms Villp
MMRRC Submission 067747-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R8380 (G1)
Quality Score 225.009
Status Not validated
Chromosome 9
Chromosomal Location 118881846-118900593 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 118886917 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 21 (T21A)
Ref Sequence ENSEMBL: ENSMUSP00000061731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000131647]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000051386
AA Change: T21A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: T21A

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074734
AA Change: T21A

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: T21A

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000131647
AA Change: T21A

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000118375
Gene: ENSMUSG00000038775
AA Change: T21A

DomainStartEndE-ValueType
SCOP:d1d4xg_ 7 85 6e-23 SMART
Blast:GEL 14 85 1e-48 BLAST
PDB:2VIL|A 15 82 1e-15 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 C T 14: 66,275,006 (GRCm39) V576I probably benign Het
Ahnak T C 19: 8,995,219 (GRCm39) V5501A probably benign Het
Als2 T C 1: 59,250,467 (GRCm39) T426A probably benign Het
Armc7 G T 11: 115,366,726 (GRCm39) probably benign Het
Atp6v1b2 A G 8: 69,556,042 (GRCm39) E239G probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Ccdc121rt3 T C 5: 112,503,191 (GRCm39) D171G probably benign Het
Cenpc1 C A 5: 86,194,275 (GRCm39) A164S probably benign Het
Cep131 T A 11: 119,967,854 (GRCm39) R134W probably damaging Het
Chek1 T A 9: 36,623,408 (GRCm39) N422I probably benign Het
Clip2 T C 5: 134,531,651 (GRCm39) E718G probably damaging Het
Cyp2c70 C T 19: 40,175,669 (GRCm39) C13Y probably benign Het
Dhx40 G A 11: 86,697,411 (GRCm39) T52M probably damaging Het
Dnhd1 G T 7: 105,327,073 (GRCm39) R674L probably benign Het
Lrrc36 T A 8: 106,153,460 (GRCm39) V90E probably damaging Het
Neb A G 2: 52,087,823 (GRCm39) Y5459H probably benign Het
Nt5c2 A T 19: 46,877,489 (GRCm39) M484K probably damaging Het
Or10c1 T A 17: 37,522,232 (GRCm39) N171Y possibly damaging Het
Or10q1b T C 19: 13,682,608 (GRCm39) I139T probably benign Het
Or11g26 T C 14: 50,753,297 (GRCm39) V212A probably benign Het
Papss1 C T 3: 131,337,456 (GRCm39) P539L probably damaging Het
Pdlim3 A T 8: 46,370,572 (GRCm39) M243L probably benign Het
Pls1 G A 9: 95,657,438 (GRCm39) H303Y probably benign Het
Pomt1 A G 2: 32,135,619 (GRCm39) T328A probably damaging Het
Rasal1 C T 5: 120,804,420 (GRCm39) R431C probably benign Het
Rnf17 TG T 14: 56,661,999 (GRCm39) 132 probably null Het
Scaf4 A G 16: 90,057,133 (GRCm39) S73P unknown Het
Snrpa G T 7: 26,886,713 (GRCm39) Q261K possibly damaging Het
Top1 A G 2: 160,559,315 (GRCm39) N613D probably benign Het
Wdr1 C G 5: 38,697,864 (GRCm39) D234H possibly damaging Het
Other mutations in Vill
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Vill APN 9 118,892,380 (GRCm39) missense probably damaging 1.00
IGL01024:Vill APN 9 118,899,418 (GRCm39) critical splice donor site probably null
IGL01934:Vill APN 9 118,895,877 (GRCm39) missense probably damaging 1.00
IGL02118:Vill APN 9 118,889,466 (GRCm39) missense probably benign 0.44
IGL02260:Vill APN 9 118,887,509 (GRCm39) missense probably benign 0.00
IGL02507:Vill APN 9 118,899,845 (GRCm39) missense possibly damaging 0.86
IGL02870:Vill APN 9 118,890,967 (GRCm39) missense probably damaging 1.00
IGL02941:Vill APN 9 118,895,955 (GRCm39) unclassified probably benign
IGL02835:Vill UTSW 9 118,896,513 (GRCm39) missense probably benign 0.11
R0285:Vill UTSW 9 118,899,895 (GRCm39) unclassified probably benign
R0571:Vill UTSW 9 118,899,701 (GRCm39) missense possibly damaging 0.93
R1024:Vill UTSW 9 118,895,892 (GRCm39) missense probably damaging 1.00
R1168:Vill UTSW 9 118,899,389 (GRCm39) missense probably damaging 0.99
R1374:Vill UTSW 9 118,890,562 (GRCm39) missense probably benign 0.03
R1400:Vill UTSW 9 118,892,415 (GRCm39) missense probably benign 0.01
R1551:Vill UTSW 9 118,892,440 (GRCm39) missense probably benign
R1584:Vill UTSW 9 118,894,654 (GRCm39) missense probably damaging 1.00
R1630:Vill UTSW 9 118,899,769 (GRCm39) missense probably benign 0.37
R1721:Vill UTSW 9 118,895,082 (GRCm39) missense probably damaging 0.98
R1946:Vill UTSW 9 118,887,560 (GRCm39) missense probably benign
R2311:Vill UTSW 9 118,894,965 (GRCm39) missense probably benign 0.08
R2392:Vill UTSW 9 118,896,628 (GRCm39) unclassified probably benign
R2509:Vill UTSW 9 118,899,370 (GRCm39) missense possibly damaging 0.84
R2760:Vill UTSW 9 118,895,950 (GRCm39) critical splice donor site probably null
R3886:Vill UTSW 9 118,895,782 (GRCm39) missense probably benign 0.24
R3944:Vill UTSW 9 118,897,499 (GRCm39) missense probably benign 0.10
R4245:Vill UTSW 9 118,900,359 (GRCm39) unclassified probably benign
R4246:Vill UTSW 9 118,889,461 (GRCm39) missense probably damaging 1.00
R4771:Vill UTSW 9 118,897,502 (GRCm39) missense probably damaging 1.00
R4889:Vill UTSW 9 118,892,409 (GRCm39) missense possibly damaging 0.50
R4932:Vill UTSW 9 118,890,579 (GRCm39) missense probably damaging 1.00
R4946:Vill UTSW 9 118,897,508 (GRCm39) missense probably damaging 1.00
R5121:Vill UTSW 9 118,899,093 (GRCm39) missense possibly damaging 0.92
R5646:Vill UTSW 9 118,900,230 (GRCm39) missense probably damaging 1.00
R6089:Vill UTSW 9 118,886,867 (GRCm39) missense probably benign 0.00
R6149:Vill UTSW 9 118,887,482 (GRCm39) missense possibly damaging 0.67
R6167:Vill UTSW 9 118,895,932 (GRCm39) missense probably damaging 0.98
R6318:Vill UTSW 9 118,892,716 (GRCm39) missense probably benign 0.15
R6319:Vill UTSW 9 118,892,716 (GRCm39) missense probably benign 0.15
R6590:Vill UTSW 9 118,890,975 (GRCm39) missense probably benign 0.04
R6690:Vill UTSW 9 118,890,975 (GRCm39) missense probably benign 0.04
R6889:Vill UTSW 9 118,894,950 (GRCm39) missense possibly damaging 0.58
R7207:Vill UTSW 9 118,900,281 (GRCm39) missense possibly damaging 0.64
R7353:Vill UTSW 9 118,894,561 (GRCm39) missense probably damaging 0.99
R7398:Vill UTSW 9 118,899,716 (GRCm39) missense probably benign 0.26
R7883:Vill UTSW 9 118,894,589 (GRCm39) nonsense probably null
R8165:Vill UTSW 9 118,895,821 (GRCm39) missense probably damaging 0.98
R8281:Vill UTSW 9 118,887,547 (GRCm39) missense probably damaging 1.00
R8685:Vill UTSW 9 118,895,795 (GRCm39) missense probably benign 0.00
R8847:Vill UTSW 9 118,897,514 (GRCm39) missense probably damaging 0.99
R8968:Vill UTSW 9 118,892,671 (GRCm39) critical splice donor site probably null
R9290:Vill UTSW 9 118,890,562 (GRCm39) missense probably benign 0.03
RF005:Vill UTSW 9 118,889,507 (GRCm39) missense probably damaging 1.00
Z1176:Vill UTSW 9 118,899,033 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGAGAATTCTCACTTGGAGC -3'
(R):5'- GACGACATAGCAGCATTCTTC -3'

Sequencing Primer
(F):5'- GGAGAATTCTCACTTGGAGCCTATAG -3'
(R):5'- TTTCAGGCAATGGCAGCATC -3'
Posted On 2020-09-02