Mutagenetix > Incidental Mutations

Incidental Mutation 'R8165:Vill'

633729

Institutional Source

Beutler Lab

Gene Symbol

Vill

Ensembl Gene

ENSMUSG00000038775

Gene Name

villin-like

Synonyms

Villp

MMRRC Submission

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.083) question?

Stock #

R8165 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

119052778-119071525 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 119066753 bp

Zygosity

Heterozygous

Amino Acid Change

Phenylalanine to Tyrosine at position 511 (F511Y)

Ref Sequence

ENSEMBL: ENSMUSP00000061731 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000136561] [ENSMUST00000141185]

Predicted Effect

probably benign
Transcript: ENSMUST00000010804

SMART Domains

Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660

Domain	Start	End	E-Value	Type
PH	22	132	9.41e-10	SMART
EFh	144	172	2.87e-2	SMART
EFh	180	208	9.34e1	SMART
Pfam:EF-hand_like	213	295	1.2e-23	PFAM
PLCXc	296	440	5.47e-94	SMART
low complexity region	461	472	N/A	INTRINSIC
PLCYc	492	609	1.22e-68	SMART
C2	630	735	1.78e-21	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000051386
AA Change: F511Y

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: F511Y

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
GEL	613	706	7.8e-16	SMART
VHP	824	859	2.12e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000074734
AA Change: F511Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: F511Y

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
VHP	740	775	2.12e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000126251
AA Change: F66Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775
AA Change: F66Y

Domain	Start	End	E-Value	Type
Blast:GEL	1	56	9e-21	BLAST
GEL	63	149	4.38e-19	SMART
GEL	168	261	7.8e-16	SMART
VHP	357	392	2.12e-17	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000136561
AA Change: F119Y

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775
AA Change: F119Y

Domain	Start	End	E-Value	Type
GEL	1	96	2.46e-13	SMART
Blast:GEL	116	140	2e-8	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000141185
AA Change: F127Y

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775
AA Change: F127Y

Domain	Start	End	E-Value	Type
GEL	7	104	7.92e-17	SMART
GEL	124	210	4.38e-19	SMART
GEL	229	322	7.8e-16	SMART
VHP	440	475	2.12e-17	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000153630

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610040J01Rik	C	A	5: 63,897,946		probably null	Het
1110037F02Rik	T	A	4: 11,542,128	D1521E	probably benign	Het
Amph	A	G	13: 19,094,837	K161E	probably benign	Het
Aox2	A	T	1: 58,308,929	H602L	probably benign	Het
Areg	A	G	5: 91,143,633	N145S	probably damaging	Het
Arhgap29	C	T	3: 121,988,573	T142I	probably damaging	Het
Bcar3	C	T	3: 122,511,156		probably benign	Het
Brpf3	C	T	17: 28,806,274	A107V	probably benign	Het
Btnl2	T	A	17: 34,368,708	S509T	possibly damaging	Het
Cacna2d2	A	G	9: 107,525,454		probably null	Het
Casz1	C	T	4: 148,944,431	P1111L	probably damaging	Het
Ccdc91	C	T	6: 147,631,588	T411I	unknown	Het
Chd9	A	C	8: 91,041,141	E2422A	probably damaging	Het
Clrn3	T	C	7: 135,528,404	I34V	probably benign	Het
Cnksr3	C	T	10: 7,154,467	D79N	probably damaging	Het
Cops8	A	G	1: 90,612,007		probably null	Het
Cpa2	A	G	6: 30,564,346	K392R	probably benign	Het
Dnajc28	G	A	16: 91,616,907	R150*	probably null	Het
Dnase1l3	T	C	14: 7,994,299		probably benign	Het
Fam65a	C	A	8: 105,620,888	L1028M	unknown	Het
Gdpd5	A	T	7: 99,456,482	T502S	probably benign	Het
Gp2	A	T	7: 119,450,152	D387E	probably damaging	Het
Gpr179	A	G	11: 97,351,538	L160P	probably benign	Het
Hmcn1	G	A	1: 150,646,658	T3497M	probably benign	Het
Idh3b	T	A	2: 130,280,500	T322S	possibly damaging	Het
Kit	A	T	5: 75,620,880	N323I	possibly damaging	Het
Kng2	T	C	16: 22,987,496	S445G	unknown	Het
Lin54	A	G	5: 100,454,499	V393A	probably benign	Het
Lyst	T	A	13: 13,698,360	W2715R	probably damaging	Het
Mad1l1	T	C	5: 140,315,058	T28A	probably benign	Het
Med7	T	A	11: 46,441,246	C223S	probably benign	Het
Megf8	T	A	7: 25,353,873	L1823Q	probably damaging	Het
Mga	C	A	2: 119,947,238	Q1755K	probably benign	Het
Mgat4b	A	T	11: 50,210,974	N22I	probably benign	Het
Ndufb6	C	T	4: 40,270,665		probably null	Het
Neil3	A	G	8: 53,589,094	L490P	probably benign	Het
Nek9	C	T	12: 85,303,643	V886I	probably benign	Het
Nol4l	A	T	2: 153,420,553	Y366*	probably null	Het
Nt5dc2	A	G	14: 31,138,929	T354A	probably damaging	Het
Olfr339	T	A	2: 36,421,703	Y102N	probably damaging	Het
Pde2a	G	A	7: 101,500,448		probably null	Het
Phf1	T	C	17: 26,937,070	F444L	possibly damaging	Het
Plin4	G	A	17: 56,107,019	T202I	possibly damaging	Het
Plk4	G	C	3: 40,813,574	V851L	probably damaging	Het
Pp2d1	A	G	17: 53,515,229	S270P	probably damaging	Het
Scn9a	A	G	2: 66,540,530	F569L	probably damaging	Het
Sel1l2	T	A	2: 140,262,706	L306F	probably damaging	Het
Spic	A	T	10: 88,677,566	S86T	probably damaging	Het
Stkld1	A	G	2: 26,946,656	N278S	probably benign	Het
Taar7d	T	A	10: 24,027,597	F126I	probably benign	Het
Tbc1d31	A	G	15: 57,960,949	E869G	possibly damaging	Het
Tbcd	C	T	11: 121,493,885	T315M	probably benign	Het
Terf2	T	C	8: 107,083,024	K221E	possibly damaging	Het
Tex43	T	A	18: 56,589,475		probably benign	Het
Thsd7a	T	A	6: 12,468,963	T539S		Het
Tll2	A	G	19: 41,088,874	F818L	possibly damaging	Het
Tmem87a	T	C	2: 120,370,478	T427A	possibly damaging	Het
Ush2a	C	A	1: 188,451,755	Q1419K	possibly damaging	Het
Vps13c	A	G	9: 67,858,790	D63G	probably benign	Het
Vrk2	A	G	11: 26,535,575	F138L	probably benign	Het
Zfp710	T	C	7: 80,086,027	I514T	probably damaging	Het
Zgrf1	T	A	3: 127,563,383	F753I	possibly damaging	Het

Other mutations in Vill

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Vill	APN	9	119063312	missense	probably damaging	1.00
IGL01024:Vill	APN	9	119070350	critical splice donor site	probably null
IGL01934:Vill	APN	9	119066809	missense	probably damaging	1.00
IGL02118:Vill	APN	9	119060398	missense	probably benign	0.44
IGL02260:Vill	APN	9	119058441	missense	probably benign	0.00
IGL02507:Vill	APN	9	119070777	missense	possibly damaging	0.86
IGL02870:Vill	APN	9	119061899	missense	probably damaging	1.00
IGL02941:Vill	APN	9	119066887	unclassified	probably benign
IGL02835:Vill	UTSW	9	119067445	missense	probably benign	0.11
R0285:Vill	UTSW	9	119070827	unclassified	probably benign
R0571:Vill	UTSW	9	119070633	missense	possibly damaging	0.93
R1024:Vill	UTSW	9	119066824	missense	probably damaging	1.00
R1168:Vill	UTSW	9	119070321	missense	probably damaging	0.99
R1374:Vill	UTSW	9	119061494	missense	probably benign	0.03
R1400:Vill	UTSW	9	119063347	missense	probably benign	0.01
R1551:Vill	UTSW	9	119063372	missense	probably benign
R1584:Vill	UTSW	9	119065586	missense	probably damaging	1.00
R1630:Vill	UTSW	9	119070701	missense	probably benign	0.37
R1721:Vill	UTSW	9	119066014	missense	probably damaging	0.98
R1946:Vill	UTSW	9	119058492	missense	probably benign
R2311:Vill	UTSW	9	119065897	missense	probably benign	0.08
R2392:Vill	UTSW	9	119067560	unclassified	probably benign
R2509:Vill	UTSW	9	119070302	missense	possibly damaging	0.84
R2760:Vill	UTSW	9	119066882	critical splice donor site	probably null
R3886:Vill	UTSW	9	119066714	missense	probably benign	0.24
R3944:Vill	UTSW	9	119068431	missense	probably benign	0.10
R4245:Vill	UTSW	9	119071291	unclassified	probably benign
R4246:Vill	UTSW	9	119060393	missense	probably damaging	1.00
R4771:Vill	UTSW	9	119068434	missense	probably damaging	1.00
R4889:Vill	UTSW	9	119063341	missense	possibly damaging	0.50
R4932:Vill	UTSW	9	119061511	missense	probably damaging	1.00
R4946:Vill	UTSW	9	119068440	missense	probably damaging	1.00
R5121:Vill	UTSW	9	119070025	missense	possibly damaging	0.92
R5646:Vill	UTSW	9	119071162	missense	probably damaging	1.00
R6089:Vill	UTSW	9	119057799	missense	probably benign	0.00
R6149:Vill	UTSW	9	119058414	missense	possibly damaging	0.67
R6167:Vill	UTSW	9	119066864	missense	probably damaging	0.98
R6318:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6319:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6590:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6690:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6889:Vill	UTSW	9	119065882	missense	possibly damaging	0.58
R7207:Vill	UTSW	9	119071213	missense	possibly damaging	0.64
R7353:Vill	UTSW	9	119065493	missense	probably damaging	0.99
R7398:Vill	UTSW	9	119070648	missense	probably benign	0.26
R7883:Vill	UTSW	9	119065521	nonsense	probably null
R8281:Vill	UTSW	9	119058479	missense	probably damaging	1.00
R8380:Vill	UTSW	9	119057849	missense	probably benign	0.04
RF005:Vill	UTSW	9	119060439	missense	probably damaging	1.00
Z1176:Vill	UTSW	9	119069965	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGTCCTGCACATAGAGGAC -3'
(R):5'- ACCATCTCTGTGGACTAAGTCTG -3'

Sequencing Primer
(F):5'- CTGCACATAGAGGACGGCAAC -3'
(R):5'- ATCTCTGTGGACTAAGTCTGCAACTG -3'

Posted On

2020-07-13