Mutagenetix > Incidental Mutation

Incidental Mutation 'R6889:Vill'

537118

Institutional Source

Beutler Lab

Gene Symbol

Vill

Ensembl Gene

ENSMUSG00000038775

Gene Name

villin-like

Synonyms

Villp

MMRRC Submission

044983-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R6889 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

119052778-119071525 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 119065882 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 56 (D56G)

Ref Sequence

ENSEMBL: ENSMUSP00000123393 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000136561] [ENSMUST00000141185]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000051386
AA Change: D448G

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: D448G

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
GEL	613	706	7.8e-16	SMART
VHP	824	859	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000074734
AA Change: D448G

PolyPhen 2 Score 0.311 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: D448G

Domain	Start	End	E-Value	Type
GEL	14	114	4.59e-13	SMART
GEL	135	227	4.18e-16	SMART
GEL	252	348	8.35e-25	SMART
GEL	391	488	7.92e-17	SMART
GEL	508	594	4.38e-19	SMART
VHP	740	775	2.12e-17	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000126251

SMART Domains

Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775

Domain	Start	End	E-Value	Type
Blast:GEL	1	56	9e-21	BLAST
GEL	63	149	4.38e-19	SMART
GEL	168	261	7.8e-16	SMART
VHP	357	392	2.12e-17	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000136561
AA Change: D56G

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775
AA Change: D56G

Domain	Start	End	E-Value	Type
GEL	1	96	2.46e-13	SMART
Blast:GEL	116	140	2e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000141185
AA Change: D64G

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775
AA Change: D64G

Domain	Start	End	E-Value	Type
GEL	7	104	7.92e-17	SMART
GEL	124	210	4.38e-19	SMART
GEL	229	322	7.8e-16	SMART
VHP	440	475	2.12e-17	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.4%
20x: 98.1%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 60 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310002L09Rik	A	T	4: 73,943,053	D103E	probably benign	Het
Abcc3	A	T	11: 94,375,555	S70T	possibly damaging	Het
Atp6v0a1	A	G	11: 101,029,183	Y214C	possibly damaging	Het
Azi2	A	G	9: 118,049,895		probably null	Het
BC067074	C	A	13: 113,318,378	S319R	probably damaging	Het
Cacnb2	T	A	2: 14,986,015	V636E	possibly damaging	Het
Cd8a	A	C	6: 71,374,562	T169P	probably damaging	Het
Cfap44	G	A	16: 44,404,132	V68I	probably benign	Het
Eea1	G	T	10: 96,037,478	C1134F	probably benign	Het
Ehmt2	T	G	17: 34,912,772	F1192V	probably damaging	Het
Emc1	T	C	4: 139,365,350	F531L	probably damaging	Het
Eme1	G	A	11: 94,650,477	T173I	probably benign	Het
Gli2	A	T	1: 118,844,416	C520S	probably damaging	Het
Gm43302	T	C	5: 105,280,138	K186E	probably benign	Het
Gpr108	A	T	17: 57,236,990	N405K	probably damaging	Het
Hmgcl	C	A	4: 135,955,642	T135N	probably benign	Het
Hydin	G	A	8: 110,532,856	D2487N	possibly damaging	Het
Igfl3	G	T	7: 18,179,800	R25L	probably benign	Het
Igsf10	A	C	3: 59,331,933	S276A	probably benign	Het
Kctd1	A	G	18: 14,973,988	S211P	probably damaging	Het
Kctd7	A	T	5: 130,152,501	Q255L	probably benign	Het
Lrig1	A	G	6: 94,625,063	Y270H	probably benign	Het
Muc5ac	C	T	7: 141,809,744		probably benign	Het
Myh15	A	G	16: 49,153,111	N1248S	possibly damaging	Het
Nod1	A	G	6: 54,944,109	F408S	probably benign	Het
Nrp1	T	C	8: 128,493,057	F652S	probably damaging	Het
Olfr1338	G	A	4: 118,754,307	T79I	probably damaging	Het
Olfr487	A	T	7: 108,211,918	F204I	probably benign	Het
Olfr574	A	T	7: 102,948,768	H91L	possibly damaging	Het
Olfr821	T	C	10: 130,034,532	M302T	probably benign	Het
Opa1	G	T	16: 29,620,868	R792L	probably benign	Het
Pcdha6	G	T	18: 36,968,343	L196F	probably damaging	Het
Pdia2	A	T	17: 26,196,970	Y347*	probably null	Het
Pdpr	G	T	8: 111,124,613		probably null	Het
Pigt	T	A	2: 164,507,331	L518Q	probably damaging	Het
Ppfibp2	A	C	7: 107,737,981	D591A	possibly damaging	Het
Prrg2	G	A	7: 45,059,989	T97M	possibly damaging	Het
Qars	A	G	9: 108,513,183	T428A	probably damaging	Het
Rai1	T	C	11: 60,185,715	F202L	probably damaging	Het
Rars	A	T	11: 35,808,486	M660K	probably damaging	Het
Rsf1	GCGGCGGCG	GCGGCGGCGTCGGCGGCG	7: 97,579,925		probably benign	Het
Slc16a6	A	C	11: 109,455,040	F382V	probably damaging	Het
Slc30a7	T	C	3: 115,954,153	T330A	probably damaging	Het
Smc1b	A	T	15: 85,067,759	L1157Q	probably damaging	Het
Snx4	G	T	16: 33,251,470	A4S	possibly damaging	Het
Sv2b	A	C	7: 75,125,767		probably null	Het
Syt9	A	T	7: 107,425,286	I129L	probably damaging	Het
Ttbk2	T	C	2: 120,773,353	E198G	probably damaging	Het
Ubr3	A	T	2: 69,944,300	D488V	possibly damaging	Het
Ush2a	T	A	1: 188,797,871	C3286S	probably damaging	Het
Vmn1r41	A	T	6: 89,747,370	I298F	probably damaging	Het
Vmn2r2	A	T	3: 64,117,267	V631D	probably damaging	Het
Vmn2r32	A	G	7: 7,472,574	S437P	possibly damaging	Het
Vmn2r53	A	G	7: 12,601,142	V197A	probably benign	Het
Wasf1	A	T	10: 40,920,369	I32F	probably damaging	Het
Wasf2	G	T	4: 133,194,730	A387S	unknown	Het
Wdr92	G	A	11: 17,222,309	V133M	probably damaging	Het
Zbtb14	G	A	17: 69,387,679	C124Y	probably damaging	Het
Zfp462	G	T	4: 55,007,671	A37S	probably damaging	Het
Zfp532	A	G	18: 65,686,990	E882G	possibly damaging	Het

Other mutations in Vill

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00943:Vill	APN	9	119063312	missense	probably damaging	1.00
IGL01024:Vill	APN	9	119070350	critical splice donor site	probably null
IGL01934:Vill	APN	9	119066809	missense	probably damaging	1.00
IGL02118:Vill	APN	9	119060398	missense	probably benign	0.44
IGL02260:Vill	APN	9	119058441	missense	probably benign	0.00
IGL02507:Vill	APN	9	119070777	missense	possibly damaging	0.86
IGL02870:Vill	APN	9	119061899	missense	probably damaging	1.00
IGL02941:Vill	APN	9	119066887	unclassified	probably benign
IGL02835:Vill	UTSW	9	119067445	missense	probably benign	0.11
R0285:Vill	UTSW	9	119070827	unclassified	probably benign
R0571:Vill	UTSW	9	119070633	missense	possibly damaging	0.93
R1024:Vill	UTSW	9	119066824	missense	probably damaging	1.00
R1168:Vill	UTSW	9	119070321	missense	probably damaging	0.99
R1374:Vill	UTSW	9	119061494	missense	probably benign	0.03
R1400:Vill	UTSW	9	119063347	missense	probably benign	0.01
R1551:Vill	UTSW	9	119063372	missense	probably benign
R1584:Vill	UTSW	9	119065586	missense	probably damaging	1.00
R1630:Vill	UTSW	9	119070701	missense	probably benign	0.37
R1721:Vill	UTSW	9	119066014	missense	probably damaging	0.98
R1946:Vill	UTSW	9	119058492	missense	probably benign
R2311:Vill	UTSW	9	119065897	missense	probably benign	0.08
R2392:Vill	UTSW	9	119067560	unclassified	probably benign
R2509:Vill	UTSW	9	119070302	missense	possibly damaging	0.84
R2760:Vill	UTSW	9	119066882	critical splice donor site	probably null
R3886:Vill	UTSW	9	119066714	missense	probably benign	0.24
R3944:Vill	UTSW	9	119068431	missense	probably benign	0.10
R4245:Vill	UTSW	9	119071291	unclassified	probably benign
R4246:Vill	UTSW	9	119060393	missense	probably damaging	1.00
R4771:Vill	UTSW	9	119068434	missense	probably damaging	1.00
R4889:Vill	UTSW	9	119063341	missense	possibly damaging	0.50
R4932:Vill	UTSW	9	119061511	missense	probably damaging	1.00
R4946:Vill	UTSW	9	119068440	missense	probably damaging	1.00
R5121:Vill	UTSW	9	119070025	missense	possibly damaging	0.92
R5646:Vill	UTSW	9	119071162	missense	probably damaging	1.00
R6089:Vill	UTSW	9	119057799	missense	probably benign	0.00
R6149:Vill	UTSW	9	119058414	missense	possibly damaging	0.67
R6167:Vill	UTSW	9	119066864	missense	probably damaging	0.98
R6318:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6319:Vill	UTSW	9	119063648	missense	probably benign	0.15
R6590:Vill	UTSW	9	119061907	missense	probably benign	0.04
R6690:Vill	UTSW	9	119061907	missense	probably benign	0.04
R7207:Vill	UTSW	9	119071213	missense	possibly damaging	0.64
R7353:Vill	UTSW	9	119065493	missense	probably damaging	0.99
R7398:Vill	UTSW	9	119070648	missense	probably benign	0.26
R7883:Vill	UTSW	9	119065521	nonsense	probably null
R8165:Vill	UTSW	9	119066753	missense	probably damaging	0.98
R8281:Vill	UTSW	9	119058479	missense	probably damaging	1.00
R8380:Vill	UTSW	9	119057849	missense	probably benign	0.04
R8685:Vill	UTSW	9	119066727	missense	probably benign	0.00
R8847:Vill	UTSW	9	119068446	missense	probably damaging	0.99
R8968:Vill	UTSW	9	119063603	critical splice donor site	probably null
R9290:Vill	UTSW	9	119061494	missense	probably benign	0.03
RF005:Vill	UTSW	9	119060439	missense	probably damaging	1.00
Z1176:Vill	UTSW	9	119069965	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCCAGCCCAAGAGCTAGAGA -3'
(R):5'- TGTGACGAAGGGATGAAAGGTCT -3'

Sequencing Primer
(F):5'- CCCAAGAGCTAGAGAGTGGAG -3'
(R):5'- AAAGGTCTGACATGGGCTCTACC -3'

Posted On

2018-10-18