Incidental Mutation 'R7398:Vill'
ID573974
Institutional Source Beutler Lab
Gene Symbol Vill
Ensembl Gene ENSMUSG00000038775
Gene Namevillin-like
SynonymsVillp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.100) question?
Stock #R7398 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location119052778-119071525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 119070648 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 767 (P767L)
Ref Sequence ENSEMBL: ENSMUSP00000061731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000010804] [ENSMUST00000051386] [ENSMUST00000074734] [ENSMUST00000126251] [ENSMUST00000136561] [ENSMUST00000141185] [ENSMUST00000213464] [ENSMUST00000214470]
Predicted Effect probably benign
Transcript: ENSMUST00000010804
SMART Domains Protein: ENSMUSP00000010804
Gene: ENSMUSG00000010660

DomainStartEndE-ValueType
PH 22 132 9.41e-10 SMART
EFh 144 172 2.87e-2 SMART
EFh 180 208 9.34e1 SMART
Pfam:EF-hand_like 213 295 1.2e-23 PFAM
PLCXc 296 440 5.47e-94 SMART
low complexity region 461 472 N/A INTRINSIC
PLCYc 492 609 1.22e-68 SMART
C2 630 735 1.78e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051386
AA Change: P767L

PolyPhen 2 Score 0.262 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000061731
Gene: ENSMUSG00000038775
AA Change: P767L

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
GEL 613 706 7.8e-16 SMART
VHP 824 859 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074734
AA Change: P683L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000074294
Gene: ENSMUSG00000038775
AA Change: P683L

DomainStartEndE-ValueType
GEL 14 114 4.59e-13 SMART
GEL 135 227 4.18e-16 SMART
GEL 252 348 8.35e-25 SMART
GEL 391 488 7.92e-17 SMART
GEL 508 594 4.38e-19 SMART
VHP 740 775 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126251
AA Change: P300L

PolyPhen 2 Score 0.069 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000116262
Gene: ENSMUSG00000038775
AA Change: P300L

DomainStartEndE-ValueType
Blast:GEL 1 56 9e-21 BLAST
GEL 63 149 4.38e-19 SMART
GEL 168 261 7.8e-16 SMART
VHP 357 392 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136561
SMART Domains Protein: ENSMUSP00000123393
Gene: ENSMUSG00000038775

DomainStartEndE-ValueType
GEL 1 96 2.46e-13 SMART
Blast:GEL 116 140 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000141185
AA Change: P383L

PolyPhen 2 Score 0.083 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000116546
Gene: ENSMUSG00000038775
AA Change: P383L

DomainStartEndE-ValueType
GEL 7 104 7.92e-17 SMART
GEL 124 210 4.38e-19 SMART
GEL 229 322 7.8e-16 SMART
VHP 440 475 2.12e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000213464
Predicted Effect probably benign
Transcript: ENSMUST00000214470
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the villin/gelsolin family. It contains 6 gelsolin-like repeats and a headpiece domain. It may play a role in actin-bundling. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abl1 T A 2: 31,790,799 S368T probably damaging Het
Acmsd A G 1: 127,729,435 probably benign Het
Arid3b A T 9: 57,796,212 S445T probably benign Het
Brinp1 A G 4: 68,841,354 V91A probably benign Het
Ccne1 A G 7: 38,106,277 probably null Het
Col3a1 A T 1: 45,327,813 I249F unknown Het
Crybg3 T C 16: 59,557,325 I1189V probably benign Het
Cyp2d34 A T 15: 82,616,763 D389E probably benign Het
D130043K22Rik A C 13: 24,893,377 I998L probably damaging Het
Dgkq A G 5: 108,655,190 I298T possibly damaging Het
Dnah17 T C 11: 118,080,724 E2161G probably damaging Het
Dnajc25 T C 4: 59,017,824 probably null Het
Dpp9 G A 17: 56,189,405 R768* probably null Het
Dusp27 A G 1: 166,100,475 S523P probably damaging Het
Dusp6 T A 10: 99,264,878 N245K probably damaging Het
E430018J23Rik C T 7: 127,393,324 C38Y probably null Het
Eea1 C A 10: 95,995,631 H195N probably benign Het
Efhc1 A G 1: 20,989,520 E598G probably benign Het
Epb41l1 T C 2: 156,534,762 V809A probably damaging Het
Gas8 T A 8: 123,518,951 M1K probably null Het
Gcm1 G A 9: 78,064,679 V301I probably benign Het
Gm11554 T A 11: 99,804,259 S43C unknown Het
Gm7298 A G 6: 121,781,953 I1177V probably benign Het
Gm8011 A G 14: 42,463,961 T27A Het
Hmcn1 A G 1: 150,646,670 I3493T probably benign Het
Insrr T G 3: 87,808,732 I578S probably damaging Het
Kif13b A G 14: 64,757,523 D908G probably null Het
Lhcgr G C 17: 88,772,046 Q71E probably benign Het
Lrrc34 T C 3: 30,643,342 D80G probably damaging Het
Lrrc7 C A 3: 158,291,958 E156* probably null Het
Lrrc9 A G 12: 72,500,816 D1255G probably damaging Het
Mcidas A G 13: 112,996,882 N116D probably benign Het
Mmp7 A G 9: 7,697,593 N210D probably damaging Het
Morc3 A G 16: 93,874,860 D926G probably damaging Het
Mrgpra9 A G 7: 47,235,637 I94T possibly damaging Het
Muc16 C A 9: 18,637,742 V5752F possibly damaging Het
Myo16 A T 8: 10,562,183 D1276V unknown Het
Nlrc4 T G 17: 74,446,542 E282A probably damaging Het
Nos2 T A 11: 78,936,471 Y227* probably null Het
Obox5 A C 7: 15,758,788 M223L probably benign Het
Olfr1337 C A 4: 118,781,699 L295F possibly damaging Het
Pygm G A 19: 6,385,936 R139H probably damaging Het
Ranbp2 C A 10: 58,467,277 P789T probably damaging Het
Riok2 T G 17: 17,387,239 S350A probably benign Het
Rnf214 C T 9: 45,867,547 V445I possibly damaging Het
Skida1 C T 2: 18,046,272 V603I unknown Het
Skint6 T A 4: 112,898,138 R747S probably benign Het
Slc24a5 G A 2: 125,085,774 W331* probably null Het
Slc5a10 A T 11: 61,673,579 C525S probably benign Het
Sult2b1 T C 7: 45,731,294 Y288C probably damaging Het
Tagln3 G T 16: 45,723,077 N67K probably damaging Het
Trav21-dv12 A T 14: 53,876,705 H94L probably benign Het
Tshz2 A G 2: 169,884,174 E230G probably damaging Het
Usb1 T A 8: 95,345,303 H210Q probably damaging Het
Vmn2r94 A T 17: 18,257,341 N269K probably benign Het
Other mutations in Vill
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00943:Vill APN 9 119063312 missense probably damaging 1.00
IGL01024:Vill APN 9 119070350 critical splice donor site probably null
IGL01934:Vill APN 9 119066809 missense probably damaging 1.00
IGL02118:Vill APN 9 119060398 missense probably benign 0.44
IGL02260:Vill APN 9 119058441 missense probably benign 0.00
IGL02507:Vill APN 9 119070777 missense possibly damaging 0.86
IGL02870:Vill APN 9 119061899 missense probably damaging 1.00
IGL02941:Vill APN 9 119066887 unclassified probably benign
IGL02835:Vill UTSW 9 119067445 missense probably benign 0.11
R0285:Vill UTSW 9 119070827 unclassified probably benign
R0571:Vill UTSW 9 119070633 missense possibly damaging 0.93
R1024:Vill UTSW 9 119066824 missense probably damaging 1.00
R1168:Vill UTSW 9 119070321 missense probably damaging 0.99
R1374:Vill UTSW 9 119061494 missense probably benign 0.03
R1400:Vill UTSW 9 119063347 missense probably benign 0.01
R1551:Vill UTSW 9 119063372 missense probably benign
R1584:Vill UTSW 9 119065586 missense probably damaging 1.00
R1630:Vill UTSW 9 119070701 missense probably benign 0.37
R1721:Vill UTSW 9 119066014 missense probably damaging 0.98
R1946:Vill UTSW 9 119058492 missense probably benign
R2311:Vill UTSW 9 119065897 missense probably benign 0.08
R2392:Vill UTSW 9 119067560 unclassified probably benign
R2509:Vill UTSW 9 119070302 missense possibly damaging 0.84
R2760:Vill UTSW 9 119066882 critical splice donor site probably null
R3886:Vill UTSW 9 119066714 missense probably benign 0.24
R3944:Vill UTSW 9 119068431 missense probably benign 0.10
R4245:Vill UTSW 9 119071291 unclassified probably benign
R4246:Vill UTSW 9 119060393 missense probably damaging 1.00
R4771:Vill UTSW 9 119068434 missense probably damaging 1.00
R4889:Vill UTSW 9 119063341 missense possibly damaging 0.50
R4932:Vill UTSW 9 119061511 missense probably damaging 1.00
R4946:Vill UTSW 9 119068440 missense probably damaging 1.00
R5121:Vill UTSW 9 119070025 missense possibly damaging 0.92
R5646:Vill UTSW 9 119071162 missense probably damaging 1.00
R6089:Vill UTSW 9 119057799 missense probably benign 0.00
R6149:Vill UTSW 9 119058414 missense possibly damaging 0.67
R6167:Vill UTSW 9 119066864 missense probably damaging 0.98
R6318:Vill UTSW 9 119063648 missense probably benign 0.15
R6319:Vill UTSW 9 119063648 missense probably benign 0.15
R6590:Vill UTSW 9 119061907 missense probably benign 0.04
R6690:Vill UTSW 9 119061907 missense probably benign 0.04
R6889:Vill UTSW 9 119065882 missense possibly damaging 0.58
R7207:Vill UTSW 9 119071213 missense possibly damaging 0.64
R7353:Vill UTSW 9 119065493 missense probably damaging 0.99
R7883:Vill UTSW 9 119065521 nonsense probably null
R7966:Vill UTSW 9 119065521 nonsense probably null
RF005:Vill UTSW 9 119060439 missense probably damaging 1.00
Z1176:Vill UTSW 9 119069965
Predicted Primers PCR Primer
(F):5'- AGAGGCCTGTGGGTTCAATG -3'
(R):5'- GTCTGCTCAGAGTGCATTATGG -3'

Sequencing Primer
(F):5'- CCTGTGGGTTCAATGTGGTC -3'
(R):5'- CCCAGTGCAGTTAGGTCTAGTAC -3'
Posted On2019-09-13