Incidental Mutation 'R8390:Olfr913'
ID647333
Institutional Source Beutler Lab
Gene Symbol Olfr913
Ensembl Gene ENSMUSG00000059189
Gene Nameolfactory receptor 913
SynonymsMOR165-9P, GA_x6K02T2PVTD-32296575-32297513, MOR165-10
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R8390 (G1)
Quality Score225.009
Status Not validated
Chromosome9
Chromosomal Location38592759-38596283 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 38594591 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 123 (Y123*)
Ref Sequence ENSEMBL: ENSMUSP00000079876 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081095]
Predicted Effect probably null
Transcript: ENSMUST00000081095
AA Change: Y123*
SMART Domains Protein: ENSMUSP00000079876
Gene: ENSMUSG00000059189
AA Change: Y123*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 2.6e-49 PFAM
Pfam:7tm_1 41 290 3.9e-23 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.5%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700069L16Rik A T 5: 113,692,780 F50I unknown Het
Abca9 A T 11: 110,145,630 M551K probably benign Het
Adgrl3 T C 5: 81,766,210 S1145P probably damaging Het
BC053393 G T 11: 46,577,255 R52L probably damaging Het
Brix1 C T 15: 10,485,868 R9H probably benign Het
C1d T C 11: 17,263,993 V83A probably damaging Het
Ciz1 G T 2: 32,367,323 V127L probably benign Het
Csnk1g3 A T 18: 53,948,078 T374S probably benign Het
Elavl1 T A 8: 4,289,623 K320* probably null Het
Foxn3 T A 12: 99,388,741 M55L probably benign Het
Gm14399 A T 2: 175,130,812 Y383* probably null Het
H2-M10.5 T A 17: 36,774,595 H215Q probably benign Het
Hsd17b13 C A 5: 103,972,646 C80F probably damaging Het
Ifi206 G T 1: 173,480,945 T495N Het
Ifi207 GTT GT 1: 173,729,450 probably null Het
Ipo13 A T 4: 117,912,337 I86N probably damaging Het
Iqcf3 T G 9: 106,560,976 E16A unknown Het
Kcnh5 T A 12: 75,087,758 D339V probably damaging Het
Lmbr1 C T 5: 29,235,042 M441I probably benign Het
Me3 G T 7: 89,849,595 G461V probably damaging Het
Mepce A G 5: 137,785,179 L295P possibly damaging Het
Mtpap T A 18: 4,396,141 Y478N probably damaging Het
Myl12a T C 17: 70,996,236 M74V probably benign Het
Neil3 A T 8: 53,609,524 M99K probably damaging Het
Nlrp3 A G 11: 59,551,790 T723A possibly damaging Het
Obscn A T 11: 59,002,044 I6792N probably benign Het
Olfr1043 A G 2: 86,162,922 V9A possibly damaging Het
Olfr1100 G A 2: 86,978,157 T213I probably benign Het
Olfr525 G T 7: 140,323,114 W138C possibly damaging Het
Olfr715 A G 7: 107,129,315 L26P probably benign Het
Peg10 T TCCC 6: 4,756,451 probably benign Het
Pitx2 C A 3: 129,218,858 N312K probably damaging Het
Pot1b C A 17: 55,692,739 V229L probably benign Het
Psmd1 A G 1: 86,078,607 I232V possibly damaging Het
Rif1 A G 2: 52,110,923 E1463G probably damaging Het
Scn5a T A 9: 119,539,538 Y307F possibly damaging Het
Shprh G A 10: 11,187,983 E1267K possibly damaging Het
Smtnl1 A T 2: 84,815,350 Y392* probably null Het
Sry GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG GCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTGGTGGTGGTCATGGAACTGCTGCTTCTGCTG Y: 2,662,638 probably benign Het
Sspo G A 6: 48,467,962 G2268R probably benign Het
Tex47 G A 5: 7,305,301 E161K probably benign Het
Tmem236 T C 2: 14,219,357 L319P probably damaging Het
Tnk1 T C 11: 69,851,869 T606A possibly damaging Het
Tnrc6a A G 7: 123,162,571 T81A probably damaging Het
Trav6d-4 A T 14: 52,753,635 T46S probably benign Het
Wdr19 T A 5: 65,223,867 Y411* probably null Het
Zfp553 A G 7: 127,236,304 T344A probably damaging Het
Zfp62 G A 11: 49,215,192 G37S probably benign Het
Other mutations in Olfr913
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01092:Olfr913 APN 9 38594905 missense probably damaging 0.98
IGL02028:Olfr913 APN 9 38594419 nonsense probably null
IGL02256:Olfr913 APN 9 38594544 missense probably benign 0.01
IGL03103:Olfr913 APN 9 38594527 missense probably damaging 1.00
IGL03297:Olfr913 APN 9 38594525 missense probably benign 0.01
R2152:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2153:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R2154:Olfr913 UTSW 9 38594411 missense probably damaging 1.00
R3176:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R3276:Olfr913 UTSW 9 38594643 missense probably damaging 1.00
R4985:Olfr913 UTSW 9 38594362 missense possibly damaging 0.88
R5043:Olfr913 UTSW 9 38594841 missense probably damaging 1.00
R5871:Olfr913 UTSW 9 38594332 missense possibly damaging 0.53
R6106:Olfr913 UTSW 9 38594956 missense probably benign 0.11
R6583:Olfr913 UTSW 9 38594964 missense possibly damaging 0.79
R6823:Olfr913 UTSW 9 38594905 missense possibly damaging 0.89
R7472:Olfr913 UTSW 9 38594904 missense probably benign 0.10
R7912:Olfr913 UTSW 9 38595150 missense probably benign 0.25
R8036:Olfr913 UTSW 9 38594890 missense probably benign 0.00
R8182:Olfr913 UTSW 9 38594544 missense probably benign 0.01
Z1177:Olfr913 UTSW 9 38594289 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGGCTAAATTCTCACCTCCAC -3'
(R):5'- TGGTACAGGAGATTTGCAGC -3'

Sequencing Primer
(F):5'- ACACACCCATGTACTTTCTCTTG -3'
(R):5'- TTTGCAGCAAAGGGAGGAGATC -3'
Posted On2020-09-02