Incidental Mutation 'R7939:Olfr476'
ID648939
Institutional Source Beutler Lab
Gene Symbol Olfr476
Ensembl Gene ENSMUSG00000095301
Gene Nameolfactory receptor 476
SynonymsMOR204-3, GA_x6K02T2PBJ9-10296787-10297719
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.086) question?
Stock #R7939 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location107964803-107969514 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 107967779 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 127 (C127*)
Ref Sequence ENSEMBL: ENSMUSP00000149760 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077249] [ENSMUST00000217173]
Predicted Effect probably null
Transcript: ENSMUST00000077249
AA Change: C127*
SMART Domains Protein: ENSMUSP00000076485
Gene: ENSMUSG00000095301
AA Change: C127*

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.7e-51 PFAM
Pfam:7tm_1 41 290 4.1e-19 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000217173
AA Change: C127*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,548,804 I415T probably damaging Het
Ackr3 A G 1: 90,214,565 S249G probably benign Het
Adgre1 G T 17: 57,449,938 A732S probably damaging Het
Ahnak T A 19: 9,014,084 L4244* probably null Het
Aldh3a2 C A 11: 61,224,598 C511F probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd11 A T 8: 122,891,073 H2013Q probably damaging Het
Atp5g3 A G 2: 73,909,862 probably null Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Chtf18 A T 17: 25,722,137 I629N probably damaging Het
Clstn3 T C 6: 124,462,199 Y33C probably damaging Het
Cmc2 T C 8: 116,889,774 R71G unknown Het
Cts7 A T 13: 61,356,550 N66K probably damaging Het
Cysltr2 C T 14: 73,029,959 V104I possibly damaging Het
Dnm3 C T 1: 162,295,596 V460I possibly damaging Het
Ecel1 C T 1: 87,149,534 V651I probably benign Het
Ext2 G A 2: 93,730,256 R522C probably damaging Het
Fam129a T G 1: 151,706,024 L457R probably damaging Het
Farp2 T C 1: 93,560,261 L70P probably damaging Het
Fnip1 T C 11: 54,502,267 Y510H probably damaging Het
Gm15446 T C 5: 109,942,494 V204A probably benign Het
Gm29394 T C 15: 58,048,650 K53E unknown Het
Gm39115 T C 7: 142,136,031 T2A unknown Het
Helz2 A G 2: 181,237,750 W692R probably damaging Het
Htra2 A T 6: 83,051,564 Y428N probably damaging Het
Khdrbs2 T A 1: 32,172,975 S20T probably benign Het
Kifap3 C A 1: 163,815,858 Y217* probably null Het
Mast2 A T 4: 116,430,471 S136T probably benign Het
Mesp1 C T 7: 79,792,986 W181* probably null Het
Mtch1 A C 17: 29,340,832 S158A probably damaging Het
Mtmr10 C A 7: 64,314,151 S211R probably benign Het
Mtmr9 C A 14: 63,534,524 Q204H probably damaging Het
Myo5a A G 9: 75,189,900 N43D Het
Myom3 G T 4: 135,807,278 probably null Het
Neb T C 2: 52,186,061 D5903G probably damaging Het
Noxred1 A G 12: 87,221,331 V342A probably benign Het
Nsd2 T A 5: 33,855,589 S421R probably benign Het
Olfr518 T C 7: 108,881,274 I111V probably benign Het
Oxa1l T C 14: 54,367,419 C270R probably benign Het
Pcdha3 T A 18: 36,947,880 N558K probably damaging Het
Pcdha7 T C 18: 36,976,010 V696A possibly damaging Het
Pigl T C 11: 62,458,680 L74P probably damaging Het
Plch2 G T 4: 155,002,778 R339S possibly damaging Het
Prdm11 G T 2: 93,012,729 D128E probably damaging Het
Ptdss1 A G 13: 66,995,347 T415A probably benign Het
Ptprj A T 2: 90,464,665 W400R probably damaging Het
Qdpr T C 5: 45,450,065 Y13C probably damaging Het
Retsat G A 6: 72,604,936 M355I probably benign Het
Slc24a1 T G 9: 64,928,366 E826D probably benign Het
Taok3 T C 5: 117,193,837 F40L probably benign Het
Tecta T C 9: 42,388,223 T190A probably damaging Het
Tmem220 C A 11: 67,030,024 T85K probably damaging Het
Traip T C 9: 107,955,878 F38L probably benign Het
Tspan1 A T 4: 116,167,012 I18N probably damaging Het
Ttc24 A T 3: 88,074,638 D40E possibly damaging Het
Ttn A T 2: 76,712,393 Y33416* probably null Het
Ttn A T 2: 76,745,761 D24929E probably damaging Het
Vmn2r16 T A 5: 109,339,839 S193T possibly damaging Het
Vmn2r83 T A 10: 79,478,817 W300R probably damaging Het
Vps13a C T 19: 16,740,791 V522M possibly damaging Het
Wdr17 C A 8: 54,687,642 R232L probably damaging Het
Wdr78 G A 4: 103,096,601 Q134* probably null Het
Wtap A T 17: 12,981,796 Y33* probably null Het
Zc3h10 A T 10: 128,544,507 V327E probably damaging Het
Zfp658 T C 7: 43,574,877 S859P possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Zfp980 A T 4: 145,702,012 H437L probably damaging Het
Other mutations in Olfr476
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01063:Olfr476 APN 7 107967534 missense probably damaging 1.00
IGL01403:Olfr476 APN 7 107967621 missense possibly damaging 0.64
IGL01564:Olfr476 APN 7 107967991 missense probably benign 0.11
IGL01615:Olfr476 APN 7 107967937 missense probably damaging 1.00
IGL01777:Olfr476 APN 7 107967502 missense probably damaging 1.00
IGL01999:Olfr476 APN 7 107967468 missense probably benign
IGL02239:Olfr476 APN 7 107968047 missense probably damaging 1.00
R0636:Olfr476 UTSW 7 107967472 missense probably benign 0.00
R1986:Olfr476 UTSW 7 107967670 missense probably benign
R5109:Olfr476 UTSW 7 107967897 missense probably benign 0.06
R6363:Olfr476 UTSW 7 107967750 missense possibly damaging 0.57
R6526:Olfr476 UTSW 7 107967462 missense probably benign 0.03
R6907:Olfr476 UTSW 7 107968252 missense probably damaging 1.00
R7063:Olfr476 UTSW 7 107968204 missense probably benign
R7218:Olfr476 UTSW 7 107967667 missense probably benign
R7240:Olfr476 UTSW 7 107968188 missense probably benign 0.42
R7444:Olfr476 UTSW 7 107967604 missense probably damaging 0.99
R8060:Olfr476 UTSW 7 107967405 missense probably benign
R8953:Olfr476 UTSW 7 107968044 missense probably benign 0.00
X0025:Olfr476 UTSW 7 107968188 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- GTGGGAAATTTCAGCATCATCAG -3'
(R):5'- TTCAACACAGCAGGGAAGTC -3'

Sequencing Primer
(F):5'- CAGTTTAATAAGAAGTTGCCCCC -3'
(R):5'- GGAAGTCACAGAAAAAGTGATCTATC -3'
Posted On2020-09-15