Incidental Mutation 'R7939:Wtap'
ID648965
Institutional Source Beutler Lab
Gene Symbol Wtap
Ensembl Gene ENSMUSG00000060475
Gene NameWilms tumour 1-associating protein
Synonyms9430038B09Rik, 2810408K05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7939 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location12966796-12992546 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 12981796 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 33 (Y33*)
Ref Sequence ENSEMBL: ENSMUSP00000007007 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007007] [ENSMUST00000159104] [ENSMUST00000159551] [ENSMUST00000159986] [ENSMUST00000160781] [ENSMUST00000162395]
Predicted Effect probably null
Transcript: ENSMUST00000007007
AA Change: Y33*
SMART Domains Protein: ENSMUSP00000007007
Gene: ENSMUSG00000060475
AA Change: Y33*

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
coiled coil region 177 248 N/A INTRINSIC
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159104
AA Change: Y10*
SMART Domains Protein: ENSMUSP00000125337
Gene: ENSMUSG00000060475
AA Change: Y10*

DomainStartEndE-ValueType
low complexity region 34 46 N/A INTRINSIC
coiled coil region 98 125 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159551
AA Change: Y33*
SMART Domains Protein: ENSMUSP00000124205
Gene: ENSMUSG00000060475
AA Change: Y33*

DomainStartEndE-ValueType
Pfam:Wtap 1 248 2.8e-157 PFAM
low complexity region 278 291 N/A INTRINSIC
low complexity region 305 327 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000159986
AA Change: Y33*
SMART Domains Protein: ENSMUSP00000123961
Gene: ENSMUSG00000060475
AA Change: Y33*

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000160781
AA Change: Y33*
SMART Domains Protein: ENSMUSP00000124138
Gene: ENSMUSG00000060475
AA Change: Y33*

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
coiled coil region 121 148 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000162395
AA Change: Y33*
SMART Domains Protein: ENSMUSP00000125419
Gene: ENSMUSG00000060475
AA Change: Y33*

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The Wilms tumor suppressor gene WT1 appears to play a role in both transcriptional and posttranscriptional regulation of certain cellular genes. This gene encodes a WT1-associating protein, which is a ubiquitously expressed nuclear protein. Like WT1 protein, this protein is localized throughout the nucleoplasm as well as in speckles and partially colocalizes with splicing factors. Alternative splicing of this gene results in several transcript variants encoding three different isoforms. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a mutation display lethality during embryogenesis with abnormalities appearing during gastrulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc12 A G 8: 86,548,804 I415T probably damaging Het
Ackr3 A G 1: 90,214,565 S249G probably benign Het
Adgre1 G T 17: 57,449,938 A732S probably damaging Het
Ahnak T A 19: 9,014,084 L4244* probably null Het
Aldh3a2 C A 11: 61,224,598 C511F probably benign Het
Ampd2 C A 3: 108,080,116 V134L probably benign Het
Ankrd11 A T 8: 122,891,073 H2013Q probably damaging Het
Atp5g3 A G 2: 73,909,862 probably null Het
Calcoco2 GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC GGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTCCTCCCAGGAGGCCTTCTCTTTCTCCCAGGAGGCCTTCTCTTCC 11: 96,099,982 probably benign Het
Chtf18 A T 17: 25,722,137 I629N probably damaging Het
Clstn3 T C 6: 124,462,199 Y33C probably damaging Het
Cmc2 T C 8: 116,889,774 R71G unknown Het
Cts7 A T 13: 61,356,550 N66K probably damaging Het
Cysltr2 C T 14: 73,029,959 V104I possibly damaging Het
Dnm3 C T 1: 162,295,596 V460I possibly damaging Het
Ecel1 C T 1: 87,149,534 V651I probably benign Het
Ext2 G A 2: 93,730,256 R522C probably damaging Het
Fam129a T G 1: 151,706,024 L457R probably damaging Het
Farp2 T C 1: 93,560,261 L70P probably damaging Het
Fnip1 T C 11: 54,502,267 Y510H probably damaging Het
Gm15446 T C 5: 109,942,494 V204A probably benign Het
Gm29394 T C 15: 58,048,650 K53E unknown Het
Gm39115 T C 7: 142,136,031 T2A unknown Het
Helz2 A G 2: 181,237,750 W692R probably damaging Het
Htra2 A T 6: 83,051,564 Y428N probably damaging Het
Khdrbs2 T A 1: 32,172,975 S20T probably benign Het
Kifap3 C A 1: 163,815,858 Y217* probably null Het
Mast2 A T 4: 116,430,471 S136T probably benign Het
Mesp1 C T 7: 79,792,986 W181* probably null Het
Mtch1 A C 17: 29,340,832 S158A probably damaging Het
Mtmr10 C A 7: 64,314,151 S211R probably benign Het
Mtmr9 C A 14: 63,534,524 Q204H probably damaging Het
Myo5a A G 9: 75,189,900 N43D Het
Myom3 G T 4: 135,807,278 probably null Het
Neb T C 2: 52,186,061 D5903G probably damaging Het
Noxred1 A G 12: 87,221,331 V342A probably benign Het
Nsd2 T A 5: 33,855,589 S421R probably benign Het
Olfr476 T A 7: 107,967,779 C127* probably null Het
Olfr518 T C 7: 108,881,274 I111V probably benign Het
Oxa1l T C 14: 54,367,419 C270R probably benign Het
Pcdha3 T A 18: 36,947,880 N558K probably damaging Het
Pcdha7 T C 18: 36,976,010 V696A possibly damaging Het
Pigl T C 11: 62,458,680 L74P probably damaging Het
Plch2 G T 4: 155,002,778 R339S possibly damaging Het
Prdm11 G T 2: 93,012,729 D128E probably damaging Het
Ptdss1 A G 13: 66,995,347 T415A probably benign Het
Ptprj A T 2: 90,464,665 W400R probably damaging Het
Qdpr T C 5: 45,450,065 Y13C probably damaging Het
Retsat G A 6: 72,604,936 M355I probably benign Het
Slc24a1 T G 9: 64,928,366 E826D probably benign Het
Taok3 T C 5: 117,193,837 F40L probably benign Het
Tecta T C 9: 42,388,223 T190A probably damaging Het
Tmem220 C A 11: 67,030,024 T85K probably damaging Het
Traip T C 9: 107,955,878 F38L probably benign Het
Tspan1 A T 4: 116,167,012 I18N probably damaging Het
Ttc24 A T 3: 88,074,638 D40E possibly damaging Het
Ttn A T 2: 76,712,393 Y33416* probably null Het
Ttn A T 2: 76,745,761 D24929E probably damaging Het
Vmn2r16 T A 5: 109,339,839 S193T possibly damaging Het
Vmn2r83 T A 10: 79,478,817 W300R probably damaging Het
Vps13a C T 19: 16,740,791 V522M possibly damaging Het
Wdr17 C A 8: 54,687,642 R232L probably damaging Het
Wdr78 G A 4: 103,096,601 Q134* probably null Het
Zc3h10 A T 10: 128,544,507 V327E probably damaging Het
Zfp658 T C 7: 43,574,877 S859P possibly damaging Het
Zfp874b A T 13: 67,474,503 C225* probably null Het
Zfp980 A T 4: 145,702,012 H437L probably damaging Het
Other mutations in Wtap
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Wtap APN 17 12967895 missense probably benign 0.08
IGL01867:Wtap APN 17 12969455 missense probably benign 0.00
IGL02379:Wtap APN 17 12969449 missense probably benign
IGL02437:Wtap APN 17 12967733 missense probably benign
IGL02975:Wtap APN 17 12983511 missense possibly damaging 0.85
ANU22:Wtap UTSW 17 12967895 missense probably benign 0.08
R1457:Wtap UTSW 17 12981744 splice site probably null
R1799:Wtap UTSW 17 12980884 missense possibly damaging 0.96
R2240:Wtap UTSW 17 12975465 nonsense probably null
R2328:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R2332:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R3426:Wtap UTSW 17 12967538 missense possibly damaging 0.53
R4382:Wtap UTSW 17 12975420 missense probably damaging 0.99
R4703:Wtap UTSW 17 12980824 missense probably benign 0.23
R4879:Wtap UTSW 17 12969435 missense probably damaging 0.99
R4956:Wtap UTSW 17 12967536 missense probably benign 0.06
R5044:Wtap UTSW 17 12967638 missense possibly damaging 0.47
R6366:Wtap UTSW 17 12968058 splice site probably null
R6813:Wtap UTSW 17 12967510 missense probably damaging 0.96
R7324:Wtap UTSW 17 12980946 missense possibly damaging 0.91
R7443:Wtap UTSW 17 12980934 missense probably benign 0.05
R7810:Wtap UTSW 17 12980910 missense probably damaging 0.99
T0970:Wtap UTSW 17 12969390 unclassified probably benign
X0067:Wtap UTSW 17 12985929 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTCTCGGAAATCGACAAAGG -3'
(R):5'- TGCCCAACCTATGTGTATGTTC -3'

Sequencing Primer
(F):5'- GATTTCTGAGTTCAAGGCCAGCC -3'
(R):5'- CTGTCTTCTGTAAATTGTGAAGAAGC -3'
Posted On2020-09-15